EMAIL THIS PAGE TO A FRIEND

PPP5C

protein phosphatase 5, catalytic subunit

120 Gene Product Result for
Synonyms: PP5 PPP5 PPT
UniProtKB ID: P53041, Q16722, Q53XV2
Gene ID:
Human(5536) Summary: This gene encodes a serine/threonine phosphatase which is a member of the protein phosphatase catalytic subunit family. Proteins in this family participate in pathways regulated by reversible phosphorylation at serine and threonine residues; many of these pathways are involved in the regulation of cell growth and differentiation. The product of this gene has been shown to participate in signaling pathways in response to hormones or cellular stress, and elevated levels of this protein may be associated with breast cancer development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2011]
Mouse(19060) protein phosphatase 5, catalytic subunit
Rat(65179) protein phosphatase 5, catalytic subunit
cow(510245) protein phosphatase 5, catalytic subunit
naked mole-rat(101696971) protein phosphatase 5, catalytic subunit
domestic guinea pig(100715770) protein phosphatase 5, catalytic subunit
Zebrafish(541536) protein phosphatase 5, catalytic subunit
Horse(100071104) protein phosphatase 5, catalytic subunit
dog(612199) protein phosphatase 5, catalytic subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306441 ANTI-PP5 (PP5C)(C-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
HPA056933 Anti-PPP5C antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB1401299 Anti-PPP5C antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA029065 Anti-PPP5C antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2105118 Anti-PPP5C, (N-terminal) antibody produced in rabbit affinity isolated antibody guinea pig, mouse, human
western blot pricing
P9868 Anti-Protein Phosphatase 5 (PP5) antibody produced in rabbit buffered aqueous solution, fractionated antiserum, pkg of ~100 μg, 1 mg/mL human
western blot pricing
SAB4100107 Monoclonal Anti-PPP5C antibody produced in mouse clone PPP5C-A88, culture supernatant human
western blot pricing
SAB4100108 Monoclonal Anti-PPP5C antibody produced in mouse clone PPP5C-C88, culture supernatant human
western blot pricing
PLA0156 Rabbit anti-PPP5C Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. bovine, chimpanzee, rabbit, mouse, marmoset, guinea pig, human, rat, gorilla, rhesus monkey, primate
immunofluorescence, immunohistochemistry, immunoprecipitation (IP), proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011155 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011155 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011155 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006247 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006247 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006247 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006247 siRNAs that have been validated in the lab human pricing
NM_031729 Rosetta Predictions rat pricing
NM_011155 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006247 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218845 validated 804
2 SASI_Hs01_00218842 predicted 968
3 SASI_Hs02_00341171 predicted 673
4 SASI_Hs01_00218844 predicted 829
5 SASI_Hs01_00218846 predicted 683
6 SASI_Hs01_00218847 predicted 1222
7 SASI_Hs01_00218848 predicted 364
8 SASI_Hs01_00218849 predicted 991
9 SASI_Hs01_00218851 predicted 1301
10 SASI_Hs02_00341172 predicted 604
11 SASI_Hs01_00218843 predicted 475
12 SASI_Hs01_00218850 predicted 661
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031729 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071948 predicted 754
2 SASI_Rn01_00071949 predicted 268
3 SASI_Rn01_00071950 predicted 692
4 SASI_Rn01_00071951 predicted 1032
5 SASI_Rn01_00071952 predicted 567
6 SASI_Rn01_00071953 predicted 1057
7 SASI_Rn01_00071954 predicted 562
8 SASI_Rn01_00071956 predicted 1179
9 SASI_Rn02_00265109 predicted 1067
10 SASI_Rn02_00265110 predicted 1510
11 SASI_Rn01_00071947 predicted 548
12 SASI_Rn01_00071955 predicted 600
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011155 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025212 predicted 585
2 SASI_Mm01_00025214 predicted 850
3 SASI_Mm01_00025215 predicted 362
4 SASI_Mm01_00025217 predicted 927
5 SASI_Mm02_00320013 predicted 612
6 SASI_Mm01_00025218 predicted 1078
7 SASI_Mm01_00025219 predicted 685
8 SASI_Mm01_00025220 predicted 1267
9 SASI_Mm01_00025221 predicted 1405
10 SASI_Mm02_00320014 predicted 1296
11 SASI_Mm01_00025213 predicted 616
12 SASI_Mm01_00025216 predicted 830
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011155
VALIDATED
PPP5C MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 5, catalytic subunit
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011155.1-937s1c1
Sequence:CCGGCCAGATCATTTCCATCTACTTCTCGAGAAGTAGATGGAAATGATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011155.1-1303s1c1
Sequence:CCGGGAGGAGAATCAACTGGACTATCTCGAGATAGTCCAGTTGATTCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011155.1-850s1c1
Sequence:CCGGCCCTATATATTTAATGGCGATCTCGAGATCGCCATTAAATATATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011155.1-421s1c1
Sequence:CCGGGTGGTGAAAGTGAAGCCTAATCTCGAGATTAGGCTTCACTTTCACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011155.1-926s1c1
Sequence:CCGGAGCTCCTGTATCCAGATCATTCTCGAGAATGATCTGGATACAGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011155.2-970s21c1
Sequence:CCGGAGCTCCTGTATCCAGATCATTCTCGAGAATGATCTGGATACAGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011155.2-981s21c1
Sequence:CCGGCCAGATCATTTCCATCTACTTCTCGAGAAGTAGATGGAAATGATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011155.2-1347s21c1
Sequence:CCGGGAGGAGAATCAACTGGACTATCTCGAGATAGTCCAGTTGATTCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011155.2-465s21c1
Sequence:CCGGGTGGTGAAAGTGAAGCCTAATCTCGAGATTAGGCTTCACTTTCACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011155
VALIDATED
PPP5C MISSION shRNA shRNA Plasmid DNA
protein phosphatase 5, catalytic subunit
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011155.1-937s1c1
Sequence:CCGGCCAGATCATTTCCATCTACTTCTCGAGAAGTAGATGGAAATGATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011155.1-1303s1c1
Sequence:CCGGGAGGAGAATCAACTGGACTATCTCGAGATAGTCCAGTTGATTCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011155.1-850s1c1
Sequence:CCGGCCCTATATATTTAATGGCGATCTCGAGATCGCCATTAAATATATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011155.1-421s1c1
Sequence:CCGGGTGGTGAAAGTGAAGCCTAATCTCGAGATTAGGCTTCACTTTCACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011155.1-926s1c1
Sequence:CCGGAGCTCCTGTATCCAGATCATTCTCGAGAATGATCTGGATACAGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011155.2-970s21c1
Sequence:CCGGAGCTCCTGTATCCAGATCATTCTCGAGAATGATCTGGATACAGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011155.2-981s21c1
Sequence:CCGGCCAGATCATTTCCATCTACTTCTCGAGAAGTAGATGGAAATGATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011155.2-1347s21c1
Sequence:CCGGGAGGAGAATCAACTGGACTATCTCGAGATAGTCCAGTTGATTCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011155.2-465s21c1
Sequence:CCGGGTGGTGAAAGTGAAGCCTAATCTCGAGATTAGGCTTCACTTTCACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011155
VALIDATED
PPP5C MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 5, catalytic subunit
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011155.1-937s1c1
Sequence:CCGGCCAGATCATTTCCATCTACTTCTCGAGAAGTAGATGGAAATGATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011155.1-1303s1c1
Sequence:CCGGGAGGAGAATCAACTGGACTATCTCGAGATAGTCCAGTTGATTCTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011155.1-850s1c1
Sequence:CCGGCCCTATATATTTAATGGCGATCTCGAGATCGCCATTAAATATATAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011155.1-421s1c1
Sequence:CCGGGTGGTGAAAGTGAAGCCTAATCTCGAGATTAGGCTTCACTTTCACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011155.1-926s1c1
Sequence:CCGGAGCTCCTGTATCCAGATCATTCTCGAGAATGATCTGGATACAGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011155.2-970s21c1
Sequence:CCGGAGCTCCTGTATCCAGATCATTCTCGAGAATGATCTGGATACAGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011155.2-981s21c1
Sequence:CCGGCCAGATCATTTCCATCTACTTCTCGAGAAGTAGATGGAAATGATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011155.2-1347s21c1
Sequence:CCGGGAGGAGAATCAACTGGACTATCTCGAGATAGTCCAGTTGATTCTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011155.2-465s21c1
Sequence:CCGGGTGGTGAAAGTGAAGCCTAATCTCGAGATTAGGCTTCACTTTCACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006247
PPP5C MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 5, catalytic subunit
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006247.x-339s1c1
Sequence:CCGGGAAGTACATCAAGGGTTATTACTCGAGTAATAACCCTTGATGTACTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006247.x-940s1c1
Sequence:CCGGCCAGATCACTTTCACCTCCTTCTCGAGAAGGAGGTGAAAGTGATCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006247.x-757s1c1
Sequence:CCGGGAGACAGAGAAGATTACAGTACTCGAGTACTGTAATCTTCTCTGTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006247.x-1306s1c1
Sequence:CCGGGAAGAGAACAACCTGGACTATCTCGAGATAGTCCAGGTTGTTCTCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006247.x-969s1c1
Sequence:CCGGCCACGAGACAGACAACATGAACTCGAGTTCATGTTGTCTGTCTCGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006247.2-801s21c1
Sequence:CCGGCTATGACCTCCTCAACATATTCTCGAGAATATGTTGAGGAGGTCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006247.2-236s21c1
Sequence:CCGGCCAGCAATGCCATCTACTATGCTCGAGCATAGTAGATGGCATTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006247.2-338s21c1
Sequence:CCGGAGAAGTACATCAAGGGTTATTCTCGAGAATAACCCTTGATGTACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006247.2-1309s21c1
Sequence:CCGGGAGAACAACCTGGACTATATCCTCGAGGATATAGTCCAGGTTGTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006247
PPP5C MISSION shRNA shRNA Plasmid DNA
protein phosphatase 5, catalytic subunit
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006247.x-339s1c1
Sequence:CCGGGAAGTACATCAAGGGTTATTACTCGAGTAATAACCCTTGATGTACTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006247.x-940s1c1
Sequence:CCGGCCAGATCACTTTCACCTCCTTCTCGAGAAGGAGGTGAAAGTGATCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006247.x-757s1c1
Sequence:CCGGGAGACAGAGAAGATTACAGTACTCGAGTACTGTAATCTTCTCTGTCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006247.x-1306s1c1
Sequence:CCGGGAAGAGAACAACCTGGACTATCTCGAGATAGTCCAGGTTGTTCTCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006247.x-969s1c1
Sequence:CCGGCCACGAGACAGACAACATGAACTCGAGTTCATGTTGTCTGTCTCGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006247.2-801s21c1
Sequence:CCGGCTATGACCTCCTCAACATATTCTCGAGAATATGTTGAGGAGGTCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006247.2-236s21c1
Sequence:CCGGCCAGCAATGCCATCTACTATGCTCGAGCATAGTAGATGGCATTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006247.2-338s21c1
Sequence:CCGGAGAAGTACATCAAGGGTTATTCTCGAGAATAACCCTTGATGTACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006247.2-1309s21c1
Sequence:CCGGGAGAACAACCTGGACTATATCCTCGAGGATATAGTCCAGGTTGTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006247
PPP5C MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 5, catalytic subunit
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006247.x-339s1c1
Sequence:CCGGGAAGTACATCAAGGGTTATTACTCGAGTAATAACCCTTGATGTACTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006247.x-940s1c1
Sequence:CCGGCCAGATCACTTTCACCTCCTTCTCGAGAAGGAGGTGAAAGTGATCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006247.x-757s1c1
Sequence:CCGGGAGACAGAGAAGATTACAGTACTCGAGTACTGTAATCTTCTCTGTCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006247.x-1306s1c1
Sequence:CCGGGAAGAGAACAACCTGGACTATCTCGAGATAGTCCAGGTTGTTCTCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006247.x-969s1c1
Sequence:CCGGCCACGAGACAGACAACATGAACTCGAGTTCATGTTGTCTGTCTCGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006247.2-801s21c1
Sequence:CCGGCTATGACCTCCTCAACATATTCTCGAGAATATGTTGAGGAGGTCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006247.2-236s21c1
Sequence:CCGGCCAGCAATGCCATCTACTATGCTCGAGCATAGTAGATGGCATTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006247.2-338s21c1
Sequence:CCGGAGAAGTACATCAAGGGTTATTCTCGAGAATAACCCTTGATGTACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006247.2-1309s21c1
Sequence:CCGGGAGAACAACCTGGACTATATCCTCGAGGATATAGTCCAGGTTGTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)