EMAIL THIS PAGE TO A FRIEND

PPP6C

protein phosphatase 6, catalytic subunit

141 Gene Product Result for
Synonyms: PP6 PP6C
UniProtKB ID: O00743, B2R5V6, B7Z2W9, B7Z5K9, Q5U0A2, Q9UIC9
Gene ID:
Human(5537) Summary: This gene encodes the catalytic subunit of protein phosphatase, a component of a signaling pathway regulating cell cycle progression. Splice variants encoding different protein isoforms exist. The pseudogene of this gene is located on chromosome X. [provided by RefSeq, Jul 2008]
Mouse(67857) protein phosphatase 6, catalytic subunit
Rat(171121) protein phosphatase 6, catalytic subunit
cow(511058) protein phosphatase 6, catalytic subunit
sheep(101106922) protein phosphatase 6, catalytic subunit
domestic guinea pig(100731843) protein phosphatase 6, catalytic subunit
naked mole-rat(101714279) protein phosphatase 6, catalytic subunit
Zebrafish(393980) protein phosphatase 6, catalytic subunit
chicken(772354) protein phosphatase 6, catalytic subunit
Horse(100070914) protein phosphatase 6, catalytic subunit
domestic cat(101082527) protein phosphatase 6, catalytic subunit
dog(608922) protein phosphatase 6, catalytic subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002721 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002721 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002721 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024209 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024209 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024209 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001123355 Rosetta Predictions human pricing
NM_001123369 Rosetta Predictions human pricing
NM_002721 siRNAs that have been validated in the lab human pricing
NM_133589 Rosetta Predictions rat pricing
NM_024209 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001123355 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327785 predicted 1104
2 SASI_Hs02_00327786 predicted 1682
3 SASI_Hs02_00327787 predicted 991
4 SASI_Hs02_00327788 predicted 863
5 SASI_Hs02_00327789 predicted 1044
6 SASI_Hs02_00327790 predicted 818
7 SASI_Hs02_00327791 predicted 1043
8 SASI_Hs02_00327792 predicted 985
9 SASI_Hs02_00327793 predicted 1706
10 SASI_Hs02_00327794 predicted 866
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001123369 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327824 predicted 921
2 SASI_Hs02_00327825 predicted 1504
3 SASI_Hs02_00327826 predicted 810
4 SASI_Hs02_00327827 predicted 679
5 SASI_Hs02_00327828 predicted 861
6 SASI_Hs02_00327829 predicted 639
7 SASI_Hs02_00327830 predicted 874
8 SASI_Hs02_00327831 predicted 803
9 SASI_Hs02_00327832 predicted 1528
10 SASI_Hs02_00327833 predicted 688
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002721 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066477 validated 996
2 SASI_Hs02_00334317 predicted 1569
3 SASI_Hs01_00066478 predicted 882
4 SASI_Hs01_00066479 predicted 748
5 SASI_Hs02_00334318 predicted 932
6 SASI_Hs01_00066481 predicted 709
7 SASI_Hs02_00334319 predicted 936
8 SASI_Hs02_00334320 predicted 876
9 SASI_Hs02_00334321 predicted 1599
10 SASI_Hs01_00066484 predicted 755
11 SASI_Hs01_00066480 predicted 347
12 SASI_Hs01_00066482 predicted 367
13 SASI_Hs01_00066483 predicted 521
14 SASI_Hs01_00066485 predicted 404
15 SASI_Hs01_00066486 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133589 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079080 predicted 216
2 SASI_Rn01_00079081 predicted 756
3 SASI_Rn01_00079082 predicted 581
4 SASI_Rn02_00267791 predicted 761
5 SASI_Rn01_00079083 predicted 588
6 SASI_Rn01_00079084 predicted 627
7 SASI_Rn01_00079085 predicted 802
8 SASI_Rn01_00079086 predicted 344
9 SASI_Rn01_00079087 predicted 349
10 SASI_Rn01_00079088 predicted 904
11 SASI_Rn01_00079089 predicted 398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024209 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036638 predicted 584
2 SASI_Mm02_00327567 predicted 589
3 SASI_Mm01_00036639 predicted 755
4 SASI_Mm01_00036640 predicted 237
5 SASI_Mm01_00036642 predicted 755
6 SASI_Mm01_00036643 predicted 430
7 SASI_Mm01_00036644 predicted 795
8 SASI_Mm01_00036645 predicted 336
9 SASI_Mm01_00036646 predicted 342
10 SASI_Mm02_00327568 predicted 392
11 SASI_Mm01_00036637 predicted 282
12 SASI_Mm01_00036641 predicted 927
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002721
VALIDATED
PPP6C MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 6, catalytic subunit
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002721.4-523s21c1
Sequence:GTACCGGCTAAATGGCCTGATCGTATTACTCGAGTAATACGATCAGGCCATTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002721.4-1111s21c1
Sequence:CCGGCCAGAACGACAACGCCATATTCTCGAGAATATGGCGTTGTCGTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002721.4-333s21c1
Sequence:CCGGGAGTCAAATGTTCAGCCAGTACTCGAGTACTGGCTGAACATTTGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002721.4-936s21c1
Sequence:GTACCGGCTAGTGCACGAAGGCTATAAACTCGAGTTTATAGCCTTCGTGCACTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002721.4-1417s21c1
Sequence:CCGGGCTTATTTACTGGTCTGGGAACTCGAGTTCCCAGACCAGTAAATAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002721.4-1026s21c1
Sequence:CCGGGCTTCGATCATGGTCTTCAAACTCGAGTTTGAAGACCATGATCGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002721.x-958s1c1
Sequence:CCGGCCAGAACGACAACGCCATATTCTCGAGAATATGGCGTTGTCGTTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002721.x-912s1c1
Sequence:CCGGCCAAAGTTATTCCGGGCAGTTCTCGAGAACTGCCCGGAATAACTTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002721.x-873s1c1
Sequence:CCGGGCTTCGATCATGGTCTTCAAACTCGAGTTTGAAGACCATGATCGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002768    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002721.x-1265s1c1
Sequence:CCGGGCTTATTTACTGGTCTGGGAACTCGAGTTCCCAGACCAGTAAATAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002721.x-180s1c1
Sequence:CCGGGAGTCAAATGTTCAGCCAGTACTCGAGTACTGGCTGAACATTTGACTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002721
VALIDATED
PPP6C MISSION shRNA shRNA Plasmid DNA
protein phosphatase 6, catalytic subunit
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002721.4-523s21c1
Sequence:GTACCGGCTAAATGGCCTGATCGTATTACTCGAGTAATACGATCAGGCCATTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002721.4-1111s21c1
Sequence:CCGGCCAGAACGACAACGCCATATTCTCGAGAATATGGCGTTGTCGTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002721.4-333s21c1
Sequence:CCGGGAGTCAAATGTTCAGCCAGTACTCGAGTACTGGCTGAACATTTGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002721.4-936s21c1
Sequence:GTACCGGCTAGTGCACGAAGGCTATAAACTCGAGTTTATAGCCTTCGTGCACTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002721.4-1417s21c1
Sequence:CCGGGCTTATTTACTGGTCTGGGAACTCGAGTTCCCAGACCAGTAAATAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002721.4-1026s21c1
Sequence:CCGGGCTTCGATCATGGTCTTCAAACTCGAGTTTGAAGACCATGATCGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002721.x-958s1c1
Sequence:CCGGCCAGAACGACAACGCCATATTCTCGAGAATATGGCGTTGTCGTTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002721.x-912s1c1
Sequence:CCGGCCAAAGTTATTCCGGGCAGTTCTCGAGAACTGCCCGGAATAACTTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002721.x-873s1c1
Sequence:CCGGGCTTCGATCATGGTCTTCAAACTCGAGTTTGAAGACCATGATCGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002768    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002721.x-1265s1c1
Sequence:CCGGGCTTATTTACTGGTCTGGGAACTCGAGTTCCCAGACCAGTAAATAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002721.x-180s1c1
Sequence:CCGGGAGTCAAATGTTCAGCCAGTACTCGAGTACTGGCTGAACATTTGACTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002721
VALIDATED
PPP6C MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 6, catalytic subunit
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002721.4-523s21c1
Sequence:GTACCGGCTAAATGGCCTGATCGTATTACTCGAGTAATACGATCAGGCCATTTAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000279890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002721.4-1111s21c1
Sequence:CCGGCCAGAACGACAACGCCATATTCTCGAGAATATGGCGTTGTCGTTCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000279950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002721.4-333s21c1
Sequence:CCGGGAGTCAAATGTTCAGCCAGTACTCGAGTACTGGCTGAACATTTGACTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000379835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002721.4-936s21c1
Sequence:GTACCGGCTAGTGCACGAAGGCTATAAACTCGAGTTTATAGCCTTCGTGCACTAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000279949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002721.4-1417s21c1
Sequence:CCGGGCTTATTTACTGGTCTGGGAACTCGAGTTCCCAGACCAGTAAATAAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000297274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002721.4-1026s21c1
Sequence:CCGGGCTTCGATCATGGTCTTCAAACTCGAGTTTGAAGACCATGATCGAAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002721.x-958s1c1
Sequence:CCGGCCAGAACGACAACGCCATATTCTCGAGAATATGGCGTTGTCGTTCTGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002721.x-912s1c1
Sequence:CCGGCCAAAGTTATTCCGGGCAGTTCTCGAGAACTGCCCGGAATAACTTTGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002721.x-873s1c1
Sequence:CCGGGCTTCGATCATGGTCTTCAAACTCGAGTTTGAAGACCATGATCGAAGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002768    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002721.x-1265s1c1
Sequence:CCGGGCTTATTTACTGGTCTGGGAACTCGAGTTCCCAGACCAGTAAATAAGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002721.x-180s1c1
Sequence:CCGGGAGTCAAATGTTCAGCCAGTACTCGAGTACTGGCTGAACATTTGACTCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024209
VALIDATED
PPP6C MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 6, catalytic subunit
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024209.1-1084s1c1
Sequence:CCGGCCAACTTTCTTGTACCCTCTACTCGAGTAGAGGGTACAAGAAAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024209.1-966s1c1
Sequence:CCGGCCAAAGTTATTCCGAGCAGTTCTCGAGAACTGCTCGGAATAACTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024209.1-614s1c1
Sequence:CCGGCGGTTTATCTCCTGATATCAACTCGAGTTGATATCAGGAGATAAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024209.1-336s1c1
Sequence:CCGGCCTGACACAAACTACATATTTCTCGAGAAATATGTAGTTTGTGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024209.1-534s1c1
Sequence:CCGGGCCTGGAGATACTGTACCAAACTCGAGTTTGGTACAGTATCTCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024209
VALIDATED
PPP6C MISSION shRNA shRNA Plasmid DNA
protein phosphatase 6, catalytic subunit
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024209.1-1084s1c1
Sequence:CCGGCCAACTTTCTTGTACCCTCTACTCGAGTAGAGGGTACAAGAAAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024209.1-966s1c1
Sequence:CCGGCCAAAGTTATTCCGAGCAGTTCTCGAGAACTGCTCGGAATAACTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024209.1-614s1c1
Sequence:CCGGCGGTTTATCTCCTGATATCAACTCGAGTTGATATCAGGAGATAAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024209.1-336s1c1
Sequence:CCGGCCTGACACAAACTACATATTTCTCGAGAAATATGTAGTTTGTGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024209.1-534s1c1
Sequence:CCGGGCCTGGAGATACTGTACCAAACTCGAGTTTGGTACAGTATCTCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024209
VALIDATED
PPP6C MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 6, catalytic subunit
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024209.1-1084s1c1
Sequence:CCGGCCAACTTTCTTGTACCCTCTACTCGAGTAGAGGGTACAAGAAAGTTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000080926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024209.1-966s1c1
Sequence:CCGGCCAAAGTTATTCCGAGCAGTTCTCGAGAACTGCTCGGAATAACTTTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000080927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024209.1-614s1c1
Sequence:CCGGCGGTTTATCTCCTGATATCAACTCGAGTTGATATCAGGAGATAAACCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000080925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024209.1-336s1c1
Sequence:CCGGCCTGACACAAACTACATATTTCTCGAGAAATATGTAGTTTGTGTCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000080924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024209.1-534s1c1
Sequence:CCGGGCCTGGAGATACTGTACCAAACTCGAGTTTGGTACAGTATCTCCAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???