EMAIL THIS PAGE TO A FRIEND

PPP6R1

protein phosphatase 6, regulatory subunit 1

89 Gene Product Result for
Synonyms: KIAA1115 PP6R1 SAP190 SAPS1
UniProtKB ID: Q9UPN7, Q2M2H3, Q504V2, Q6NVJ6, Q9BU97
Gene ID:
Human(22870) Summary: Protein phosphatase regulatory subunits, such as SAPS1, modulate the activity of protein phosphatase catalytic subunits by restricting substrate specificity, recruiting substrates, and determining the intracellular localization of the holoenzyme. SAPS1 is a regulatory subunit for the protein phosphatase-6 catalytic subunit (PPP6C; MIM 612725) (Stefansson and Brautigan, 2006 [PubMed 16769727]
Mouse(243819) protein phosphatase 6, regulatory subunit 1
Rat(361502) protein phosphatase 6, regulatory subunit 1
dog(484298) protein phosphatase 6, regulatory subunit 1
Horse(100055529) protein phosphatase 6, regulatory subunit 1
domestic cat(101085846) protein phosphatase 6, regulatory subunit 1
naked mole-rat(101709601) protein phosphatase 6, regulatory subunit 1
domestic guinea pig(100713539) protein phosphatase 6, regulatory subunit 1
cow(511840) protein phosphatase 6, regulatory subunit 1
sheep(101121797) protein phosphatase 6, regulatory subunit 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014931 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014931 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014931 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172894 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172894 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172894 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014931 Rosetta Predictions human pricing
XM_001071295 Rosetta Predictions rat pricing
XM_341781 Rosetta Predictions rat pricing
NM_172894 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014931 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222781 predicted 971
2 SASI_Hs01_00222782 predicted 2024
3 SASI_Hs01_00222783 predicted 1619
4 SASI_Hs01_00222784 predicted 404
5 SASI_Hs01_00222785 predicted 643
6 SASI_Hs01_00222786 predicted 1436
7 SASI_Hs01_00222787 predicted 1388
8 SASI_Hs01_00222788 predicted 1846
9 SASI_Hs01_00222789 predicted 1974
10 SASI_Hs01_00222790 predicted 472
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071295 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00334560 predicted 1052
2 SASI_Rn02_00334561 predicted 2107
3 SASI_Rn02_00334562 predicted 1629
4 SASI_Rn02_00334563 predicted 3074
5 SASI_Rn02_00334564 predicted 1697
6 SASI_Rn02_00334565 predicted 1172
7 SASI_Rn02_00334566 predicted 2333
8 SASI_Rn02_00334567 predicted 2312
9 SASI_Rn02_00334568 predicted 2264
10 SASI_Rn02_00334569 predicted 1740
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341781 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393343 predicted 1054
2 SASI_Rn02_00393344 predicted 2105
3 SASI_Rn02_00393345 predicted 1623
4 SASI_Rn02_00393346 predicted 1705
5 SASI_Rn02_00393347 predicted 2297
6 SASI_Rn02_00393348 predicted 1178
7 SASI_Rn02_00393349 predicted 2338
8 SASI_Rn02_00393350 predicted 2307
9 SASI_Rn02_00393351 predicted 2260
10 SASI_Rn02_00393352 predicted 1737
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172894 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140738 predicted 2019
2 SASI_Mm01_00140739 predicted 1659
3 SASI_Mm01_00140740 predicted 2243
4 SASI_Mm01_00140741 predicted 2989
5 SASI_Mm01_00140742 predicted 2210
6 SASI_Mm01_00140743 predicted 1084
7 SASI_Mm01_00140744 predicted 2222
8 SASI_Mm01_00140745 predicted 477
9 SASI_Mm01_00140746 predicted 2171
10 SASI_Mm02_00344874 predicted 2247
11 SASI_Mm01_00140747 predicted 2904
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014931
VALIDATED
PPP6R1 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 6, regulatory subunit 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130252    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_014931.2-2950s1c1
Sequence:CCGGCCATTTGCACTGAGAAGAGAACTCGAGTTCTCTTCTCAGTGCAAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129846    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_014931.2-3003s1c1
Sequence:CCGGCAGAGAGTCAAATAGAGAGAACTCGAGTTCTCTCTATTTGACTCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014931.2-3017s1c1
Sequence:CCGGGAGAGAATGGAGAGAGAGAAACTCGAGTTTCTCTCTCTCCATTCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014931.2-1289s1c1
Sequence:CCGGGCTGGACCTCTTCTTCCATTACTCGAGTAATGGAAGAAGAGGTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014931.2-1919s1c1
Sequence:CCGGCCTCAATGCTGACGATGAGAACTCGAGTTCTCATCGTCAGCATTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014931.2-1952s1c1
Sequence:CCGGCCTACTTGAGATATGCTACAACTCGAGTTGTAGCATATCTCAAGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014931.2-878s1c1
Sequence:CCGGGCAGCTCTTAAGCAACATGTTCTCGAGAACATGTTGCTTAAGAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014931
VALIDATED
PPP6R1 MISSION shRNA shRNA Plasmid DNA
protein phosphatase 6, regulatory subunit 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130252    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_014931.2-2950s1c1
Sequence:CCGGCCATTTGCACTGAGAAGAGAACTCGAGTTCTCTTCTCAGTGCAAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129846    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_014931.2-3003s1c1
Sequence:CCGGCAGAGAGTCAAATAGAGAGAACTCGAGTTCTCTCTATTTGACTCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014931.2-3017s1c1
Sequence:CCGGGAGAGAATGGAGAGAGAGAAACTCGAGTTTCTCTCTCTCCATTCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014931.2-1289s1c1
Sequence:CCGGGCTGGACCTCTTCTTCCATTACTCGAGTAATGGAAGAAGAGGTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014931.2-1919s1c1
Sequence:CCGGCCTCAATGCTGACGATGAGAACTCGAGTTCTCATCGTCAGCATTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014931.2-1952s1c1
Sequence:CCGGCCTACTTGAGATATGCTACAACTCGAGTTGTAGCATATCTCAAGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014931.2-878s1c1
Sequence:CCGGGCAGCTCTTAAGCAACATGTTCTCGAGAACATGTTGCTTAAGAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014931
VALIDATED
PPP6R1 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 6, regulatory subunit 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130252    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_014931.2-2950s1c1
Sequence:CCGGCCATTTGCACTGAGAAGAGAACTCGAGTTCTCTTCTCAGTGCAAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129846    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_014931.2-3003s1c1
Sequence:CCGGCAGAGAGTCAAATAGAGAGAACTCGAGTTCTCTCTATTTGACTCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014931.2-3017s1c1
Sequence:CCGGGAGAGAATGGAGAGAGAGAAACTCGAGTTTCTCTCTCTCCATTCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014931.2-1289s1c1
Sequence:CCGGGCTGGACCTCTTCTTCCATTACTCGAGTAATGGAAGAAGAGGTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014931.2-1919s1c1
Sequence:CCGGCCTCAATGCTGACGATGAGAACTCGAGTTCTCATCGTCAGCATTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014931.2-1952s1c1
Sequence:CCGGCCTACTTGAGATATGCTACAACTCGAGTTGTAGCATATCTCAAGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014931.2-878s1c1
Sequence:CCGGGCAGCTCTTAAGCAACATGTTCTCGAGAACATGTTGCTTAAGAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172894
VALIDATED
PPP6R1 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 6, regulatory subunit 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249568    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172894.2-3120s21c1
Sequence:CCGGTTGGTGGCCCTCTACTCTATTCTCGAGAATAGAGTAGAGGGCCACCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201785    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172894.2-3298s1c1
Sequence:CCGGGCGAGAGAGAGAGAGAAGTATCTCGAGATACTTCTCTCTCTCTCTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191524    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172894.2-3223s1c1
Sequence:CCGGGAGAAGAGAAACTATGGAGTTCTCGAGAACTCCATAGTTTCTCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172894.2-2217s21c1
Sequence:CCGGGAAAGTGTGAATGCACCATTTCTCGAGAAATGGTGCATTCACACTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172894.2-1750s21c1
Sequence:CCGGTCCCAAACCCTATCGTGAAACCTCGAGGTTTCACGATAGGGTTTGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172894.2-1398s21c1
Sequence:CCGGGATGATGCACTGTCTAGTATGCTCGAGCATACTAGACAGTGCATCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172894.2-1398s1c1
Sequence:CCGGGATGATGCACTGTCTAGTATGCTCGAGCATACTAGACAGTGCATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172894.2-1649s1c1
Sequence:CCGGCCACTATGTATTCAACAACTTCTCGAGAAGTTGTTGAATACATAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172894.2-2217s1c1
Sequence:CCGGGAAAGTGTGAATGCACCATTTCTCGAGAAATGGTGCATTCACACTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172894.2-2024s1c1
Sequence:CCGGGAACACAGTGGATCTGGTAAACTCGAGTTTACCAGATCCACTGTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172894.2-580s21c1
Sequence:CCGGAGGAGTGCAAGGTGGTCAATCCTCGAGGATTGACCACCTTGCACTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172894
VALIDATED
PPP6R1 MISSION shRNA shRNA Plasmid DNA
protein phosphatase 6, regulatory subunit 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249568    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172894.2-3120s21c1
Sequence:CCGGTTGGTGGCCCTCTACTCTATTCTCGAGAATAGAGTAGAGGGCCACCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201785    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172894.2-3298s1c1
Sequence:CCGGGCGAGAGAGAGAGAGAAGTATCTCGAGATACTTCTCTCTCTCTCTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191524    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172894.2-3223s1c1
Sequence:CCGGGAGAAGAGAAACTATGGAGTTCTCGAGAACTCCATAGTTTCTCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172894.2-2217s21c1
Sequence:CCGGGAAAGTGTGAATGCACCATTTCTCGAGAAATGGTGCATTCACACTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172894.2-1750s21c1
Sequence:CCGGTCCCAAACCCTATCGTGAAACCTCGAGGTTTCACGATAGGGTTTGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172894.2-1398s21c1
Sequence:CCGGGATGATGCACTGTCTAGTATGCTCGAGCATACTAGACAGTGCATCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172894.2-1398s1c1
Sequence:CCGGGATGATGCACTGTCTAGTATGCTCGAGCATACTAGACAGTGCATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172894.2-1649s1c1
Sequence:CCGGCCACTATGTATTCAACAACTTCTCGAGAAGTTGTTGAATACATAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172894.2-2217s1c1
Sequence:CCGGGAAAGTGTGAATGCACCATTTCTCGAGAAATGGTGCATTCACACTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172894.2-2024s1c1
Sequence:CCGGGAACACAGTGGATCTGGTAAACTCGAGTTTACCAGATCCACTGTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172894.2-580s21c1
Sequence:CCGGAGGAGTGCAAGGTGGTCAATCCTCGAGGATTGACCACCTTGCACTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172894
VALIDATED
PPP6R1 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 6, regulatory subunit 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249568    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172894.2-3120s21c1
Sequence:CCGGTTGGTGGCCCTCTACTCTATTCTCGAGAATAGAGTAGAGGGCCACCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201785    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172894.2-3298s1c1
Sequence:CCGGGCGAGAGAGAGAGAGAAGTATCTCGAGATACTTCTCTCTCTCTCTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191524    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172894.2-3223s1c1
Sequence:CCGGGAGAAGAGAAACTATGGAGTTCTCGAGAACTCCATAGTTTCTCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172894.2-2217s21c1
Sequence:CCGGGAAAGTGTGAATGCACCATTTCTCGAGAAATGGTGCATTCACACTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172894.2-1750s21c1
Sequence:CCGGTCCCAAACCCTATCGTGAAACCTCGAGGTTTCACGATAGGGTTTGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172894.2-1398s21c1
Sequence:CCGGGATGATGCACTGTCTAGTATGCTCGAGCATACTAGACAGTGCATCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172894.2-1398s1c1
Sequence:CCGGGATGATGCACTGTCTAGTATGCTCGAGCATACTAGACAGTGCATCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172894.2-1649s1c1
Sequence:CCGGCCACTATGTATTCAACAACTTCTCGAGAAGTTGTTGAATACATAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172894.2-2217s1c1
Sequence:CCGGGAAAGTGTGAATGCACCATTTCTCGAGAAATGGTGCATTCACACTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172894.2-2024s1c1
Sequence:CCGGGAACACAGTGGATCTGGTAAACTCGAGTTTACCAGATCCACTGTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172894.2-580s21c1
Sequence:CCGGAGGAGTGCAAGGTGGTCAATCCTCGAGGATTGACCACCTTGCACTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)