EMAIL THIS PAGE TO A FRIEND

PPP6R2

protein phosphatase 6, regulatory subunit 2

78 Gene Product Result for
Synonyms: KIAA0685 PP6R2 SAP190 SAPS2
Gene ID:
Human(9701) Summary: Protein phosphatase regulatory subunits, such as SAPS2, modulate the activity of protein phosphatase catalytic subunits by restricting substrate specificity, recruiting substrates, and determining the intracellular localization of the holoenzyme. SAPS2 is a regulatory subunit for the protein phosphatase-6 catalytic subunit (PPP6C; MIM 612725) (Stefansson and Brautigan, 2006 [PubMed 16769727]
Mouse(71474) protein phosphatase 6, regulatory subunit 2
Rat(300146) protein phosphatase 6, regulatory subunit 2
cow(510764) protein phosphatase 6, regulatory subunit 2
sheep(101116982) protein phosphatase 6, regulatory subunit 2
domestic guinea pig(100720382) protein phosphatase 6, regulatory subunit 2
naked mole-rat(101701944) protein phosphatase 6, regulatory subunit 2
chicken(430580) protein phosphatase 6, regulatory subunit 2
dog(481191) protein phosphatase 6, regulatory subunit 2
Horse(100055355) protein phosphatase 6, regulatory subunit 2
domestic cat(101084465) protein phosphatase 6, regulatory subunit 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA030656 Anti-PPP6R2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027805 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027805 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027805 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014678 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014678 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014678 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014678 Rosetta Predictions human pricing
NM_001106789 Rosetta Predictions rat pricing
NM_026813 Rosetta Predictions mouse pricing
NM_027805 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014678 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021724 predicted 2001
2 SASI_Hs01_00021725 predicted 1970
3 SASI_Hs01_00021726 predicted 2070
4 SASI_Hs01_00021727 predicted 1994
5 SASI_Hs01_00021728 predicted 985
6 SASI_Hs01_00021729 predicted 967
7 SASI_Hs01_00021730 predicted 615
8 SASI_Hs01_00021731 predicted 989
9 SASI_Hs01_00021732 predicted 2602
10 SASI_Hs01_00021733 predicted 1487
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106789 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222418 predicted 599
2 SASI_Rn02_00222419 predicted 1580
3 SASI_Rn02_00222420 predicted 2626
4 SASI_Rn02_00222421 predicted 2231
5 SASI_Rn02_00222422 predicted 1739
6 SASI_Rn02_00222423 predicted 1030
7 SASI_Rn02_00222424 predicted 1509
8 SASI_Rn02_00222425 predicted 2509
9 SASI_Rn02_00222426 predicted 1203
10 SASI_Rn02_00222427 predicted 1220
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026813 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113820 predicted 985
2 SASI_Mm01_00113821 predicted 817
3 SASI_Mm01_00113822 predicted 841
4 SASI_Mm01_00113823 predicted 838
5 SASI_Mm02_00330945 predicted 894
6 SASI_Mm01_00113825 predicted 856
7 SASI_Mm02_00330946 predicted 897
8 SASI_Mm01_00113826 predicted 970
9 SASI_Mm01_00113828 predicted 609
10 SASI_Mm02_00330947 predicted 821
11 SASI_Mm01_00113824 predicted 849
12 SASI_Mm01_00113827 predicted 991
13 SASI_Mm01_00113829 predicted 855
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027805 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087207 predicted 986
2 SASI_Mm01_00087208 predicted 818
3 SASI_Mm01_00087209 predicted 844
4 SASI_Mm01_00087210 predicted 840
5 SASI_Mm02_00332748 predicted 892
6 SASI_Mm01_00087212 predicted 852
7 SASI_Mm02_00332749 predicted 898
8 SASI_Mm01_00087213 predicted 971
9 SASI_Mm01_00087215 predicted 603
10 SASI_Mm02_00332750 predicted 815
11 SASI_Mm01_00087211 predicted 848
12 SASI_Mm01_00087214 predicted 993
13 SASI_Mm01_00087216 predicted 855
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027805
PPP6R2 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 6, regulatory subunit 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027805.2-979s21c1
Sequence:CCGGCAAGACCATTGGCAATCTTATCTCGAGATAAGATTGCCAATGGTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027805.2-1146s21c1
Sequence:CCGGAGGTCCTACATTGGCTGAATGCTCGAGCATTCAGCCAATGTAGGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027805.1-683s1c1
Sequence:CCGGGCTGATGGATGAAGATGACATCTCGAGATGTCATCTTCATCCATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027805.2-1668s1c1
Sequence:CCGGGTCAGTAACAAGTACCCTTTACTCGAGTAAAGGGTACTTGTTACTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027805.2-1329s21c1
Sequence:CCGGAGAGGACCATTAGATACTTTCCTCGAGGAAAGTATCTAATGGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248897    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027805.2-1359s21c1
Sequence:CCGGATGCTAATGTCTGGGTAATTTCTCGAGAAATTACCCAGACATTAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027805.2-979s1c1
Sequence:CCGGCAAGACCATTGGCAATCTTATCTCGAGATAAGATTGCCAATGGTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027805.1-1328s1c1
Sequence:CCGGGAAGAGGACCATTAGATACTTCTCGAGAAGTATCTAATGGTCCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027805.2-821s21c1
Sequence:CCGGGTCCGATTCAAATACCCAAACCTCGAGGTTTGGGTATTTGAATCGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027805
PPP6R2 MISSION shRNA shRNA Plasmid DNA
protein phosphatase 6, regulatory subunit 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027805.2-979s21c1
Sequence:CCGGCAAGACCATTGGCAATCTTATCTCGAGATAAGATTGCCAATGGTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027805.2-1146s21c1
Sequence:CCGGAGGTCCTACATTGGCTGAATGCTCGAGCATTCAGCCAATGTAGGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027805.1-683s1c1
Sequence:CCGGGCTGATGGATGAAGATGACATCTCGAGATGTCATCTTCATCCATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027805.2-1668s1c1
Sequence:CCGGGTCAGTAACAAGTACCCTTTACTCGAGTAAAGGGTACTTGTTACTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027805.2-1329s21c1
Sequence:CCGGAGAGGACCATTAGATACTTTCCTCGAGGAAAGTATCTAATGGTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248897    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027805.2-1359s21c1
Sequence:CCGGATGCTAATGTCTGGGTAATTTCTCGAGAAATTACCCAGACATTAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027805.2-979s1c1
Sequence:CCGGCAAGACCATTGGCAATCTTATCTCGAGATAAGATTGCCAATGGTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027805.1-1328s1c1
Sequence:CCGGGAAGAGGACCATTAGATACTTCTCGAGAAGTATCTAATGGTCCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027805.2-821s21c1
Sequence:CCGGGTCCGATTCAAATACCCAAACCTCGAGGTTTGGGTATTTGAATCGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027805
PPP6R2 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 6, regulatory subunit 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027805.2-979s21c1
Sequence:CCGGCAAGACCATTGGCAATCTTATCTCGAGATAAGATTGCCAATGGTCTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000248898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027805.2-1146s21c1
Sequence:CCGGAGGTCCTACATTGGCTGAATGCTCGAGCATTCAGCCAATGTAGGACCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000190471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027805.1-683s1c1
Sequence:CCGGGCTGATGGATGAAGATGACATCTCGAGATGTCATCTTCATCCATCAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000216378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027805.2-1668s1c1
Sequence:CCGGGTCAGTAACAAGTACCCTTTACTCGAGTAAAGGGTACTTGTTACTGACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000248895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027805.2-1329s21c1
Sequence:CCGGAGAGGACCATTAGATACTTTCCTCGAGGAAAGTATCTAATGGTCCTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000248897    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027805.2-1359s21c1
Sequence:CCGGATGCTAATGTCTGGGTAATTTCTCGAGAAATTACCCAGACATTAGCATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000217017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027805.2-979s1c1
Sequence:CCGGCAAGACCATTGGCAATCTTATCTCGAGATAAGATTGCCAATGGTCTTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000201364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027805.1-1328s1c1
Sequence:CCGGGAAGAGGACCATTAGATACTTCTCGAGAAGTATCTAATGGTCCTCTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000248896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027805.2-821s21c1
Sequence:CCGGGTCCGATTCAAATACCCAAACCTCGAGGTTTGGGTATTTGAATCGGACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014678
VALIDATED
PPP6R2 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 6, regulatory subunit 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014678.2-977s1c1
Sequence:CCGGGATGAAGATAGGCAGTCAAATCTCGAGATTTGACTGCCTATCTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014678.2-1489s1c1
Sequence:CCGGGCTGGACTTGTTCTTTAAGTACTCGAGTACTTAAAGAACAAGTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014678.2-1541s1c1
Sequence:CCGGGAACTATGCATAGCCGCTATTCTCGAGAATAGCGGCTATGCATAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014678.2-440s1c1
Sequence:CCGGCAGGAGTTAATGGATGAAGATCTCGAGATCTTCATCCATTAACTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014678.2-2048s1c1
Sequence:CCGGGACCAGGACGACAACATCAATCTCGAGATTGATGTTGTCGTCCTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014678.2-741s1c1
Sequence:CCGGGCAAGACCATTGGCAATCTCACTCGAGTGAGATTGCCAATGGTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014678.2-808s1c1
Sequence:CCGGCAAGTTCATCAGCCTGGTGTTCTCGAGAACACCAGGCTGATGAACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014678.2-922s1c1
Sequence:CCGGGCTGAATGAAGAGAAGGTCATCTCGAGATGACCTTCTCTTCATTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014678.2-587s1c1
Sequence:CCGGCGCTTCAAATATCCAAACACACTCGAGTGTGTTTGGATATTTGAAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014678.2-1335s1c1
Sequence:CCGGCCAAGAAGAAAGCGATCCTGACTCGAGTCAGGATCGCTTTCTTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014678.2-1178s1c1
Sequence:CCGGGTGTTACTCACCTTGCTGGAACTCGAGTTCCAGCAAGGTGAGTAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014678.2-683s1c1
Sequence:CCGGCTGTACGACTTCTTGGACCATCTCGAGATGGTCCAAGAAGTCGTACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014678
VALIDATED
PPP6R2 MISSION shRNA shRNA Plasmid DNA
protein phosphatase 6, regulatory subunit 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014678.2-977s1c1
Sequence:CCGGGATGAAGATAGGCAGTCAAATCTCGAGATTTGACTGCCTATCTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014678.2-1489s1c1
Sequence:CCGGGCTGGACTTGTTCTTTAAGTACTCGAGTACTTAAAGAACAAGTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014678.2-1541s1c1
Sequence:CCGGGAACTATGCATAGCCGCTATTCTCGAGAATAGCGGCTATGCATAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014678.2-440s1c1
Sequence:CCGGCAGGAGTTAATGGATGAAGATCTCGAGATCTTCATCCATTAACTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014678.2-2048s1c1
Sequence:CCGGGACCAGGACGACAACATCAATCTCGAGATTGATGTTGTCGTCCTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014678.2-741s1c1
Sequence:CCGGGCAAGACCATTGGCAATCTCACTCGAGTGAGATTGCCAATGGTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014678.2-808s1c1
Sequence:CCGGCAAGTTCATCAGCCTGGTGTTCTCGAGAACACCAGGCTGATGAACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014678.2-922s1c1
Sequence:CCGGGCTGAATGAAGAGAAGGTCATCTCGAGATGACCTTCTCTTCATTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014678.2-587s1c1
Sequence:CCGGCGCTTCAAATATCCAAACACACTCGAGTGTGTTTGGATATTTGAAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014678.2-1335s1c1
Sequence:CCGGCCAAGAAGAAAGCGATCCTGACTCGAGTCAGGATCGCTTTCTTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014678.2-1178s1c1
Sequence:CCGGGTGTTACTCACCTTGCTGGAACTCGAGTTCCAGCAAGGTGAGTAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014678.2-683s1c1
Sequence:CCGGCTGTACGACTTCTTGGACCATCTCGAGATGGTCCAAGAAGTCGTACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014678
VALIDATED
PPP6R2 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 6, regulatory subunit 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014678.2-977s1c1
Sequence:CCGGGATGAAGATAGGCAGTCAAATCTCGAGATTTGACTGCCTATCTTCATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000144656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014678.2-1489s1c1
Sequence:CCGGGCTGGACTTGTTCTTTAAGTACTCGAGTACTTAAAGAACAAGTCCAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000143209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014678.2-1541s1c1
Sequence:CCGGGAACTATGCATAGCCGCTATTCTCGAGAATAGCGGCTATGCATAGTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000145052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014678.2-440s1c1
Sequence:CCGGCAGGAGTTAATGGATGAAGATCTCGAGATCTTCATCCATTAACTCCTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000139866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014678.2-2048s1c1
Sequence:CCGGGACCAGGACGACAACATCAATCTCGAGATTGATGTTGTCGTCCTGGTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000139407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014678.2-741s1c1
Sequence:CCGGGCAAGACCATTGGCAATCTCACTCGAGTGAGATTGCCAATGGTCTTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000139026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014678.2-808s1c1
Sequence:CCGGCAAGTTCATCAGCCTGGTGTTCTCGAGAACACCAGGCTGATGAACTTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000122130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014678.2-922s1c1
Sequence:CCGGGCTGAATGAAGAGAAGGTCATCTCGAGATGACCTTCTCTTCATTCAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000121575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014678.2-587s1c1
Sequence:CCGGCGCTTCAAATATCCAAACACACTCGAGTGTGTTTGGATATTTGAAGCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000140903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014678.2-1335s1c1
Sequence:CCGGCCAAGAAGAAAGCGATCCTGACTCGAGTCAGGATCGCTTTCTTCTTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000139709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014678.2-1178s1c1
Sequence:CCGGGTGTTACTCACCTTGCTGGAACTCGAGTTCCAGCAAGGTGAGTAACACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000139734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014678.2-683s1c1
Sequence:CCGGCTGTACGACTTCTTGGACCATCTCGAGATGGTCCAAGAAGTCGTACAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???