EMAIL THIS PAGE TO A FRIEND

PPP6R3

protein phosphatase 6, regulatory subunit 3

181 Gene Product Result for
Synonyms: C11orf23 PP6R3 SAP190 SAPL SAPLa SAPS3
Gene ID:
Human(55291) Summary: Protein phosphatase regulatory subunits, such as SAPS3, modulate the activity of protein phosphatase catalytic subunits by restricting substrate specificity, recruiting substrates, and determining the intracellular localization of the holoenzyme. SAPS3 is a regulatory subunit for the protein phosphatase-6 catalytic subunit (PPP6C; MIM 612725) (Stefansson and Brautigan, 2006 [PubMed 16769727]
Mouse(52036) protein phosphatase 6, regulatory subunit 3
Rat(309144) protein phosphatase 6, regulatory subunit 3
Zebrafish(324530) protein phosphatase 6, regulatory subunit 3
chicken(423116) protein phosphatase 6, regulatory subunit 3
dog(483688) protein phosphatase 6, regulatory subunit 3
domestic cat(101094955) protein phosphatase 6, regulatory subunit 3
naked mole-rat(101716981) protein phosphatase 6, regulatory subunit 3
Domestic Rabbit(100338706) protein phosphatase 6, regulatory subunit 3
domestic guinea pig(100728139) protein phosphatase 6, regulatory subunit 3
cow(515218) protein phosphatase 6, regulatory subunit 3
sheep(101113973) protein phosphatase 6, regulatory subunit 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018312 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018312 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018312 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029456 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029456 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029456 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018312 Rosetta Predictions human pricing
XM_001067905 Rosetta Predictions rat pricing
XM_239014 Rosetta Predictions rat pricing
NM_029456 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018312 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351723 predicted 1868
2 SASI_Hs02_00351724 predicted 1635
3 SASI_Hs01_00068425 predicted 1724
4 SASI_Hs01_00068426 predicted 1342
5 SASI_Hs01_00068427 predicted 1858
6 SASI_Hs02_00351725 predicted 372
7 SASI_Hs01_00068428 predicted 824
8 SASI_Hs01_00068429 predicted 805
9 SASI_Hs01_00068430 predicted 1444
10 SASI_Hs01_00068431 predicted 1568
11 SASI_Hs01_00068432 predicted 1501
12 SASI_Hs01_00068433 predicted 2490
13 SASI_Hs01_00068434 predicted 464
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067905 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00322782 predicted 1986
2 SASI_Rn02_00322783 predicted 1073
3 SASI_Rn02_00322784 predicted 2076
4 SASI_Rn02_00322785 predicted 671
5 SASI_Rn02_00322786 predicted 426
6 SASI_Rn02_00322787 predicted 1770
7 SASI_Rn02_00322788 predicted 1401
8 SASI_Rn02_00322789 predicted 269
9 SASI_Rn02_00322790 predicted 550
10 SASI_Rn02_00322791 predicted 2398
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_239014 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00125931 predicted 5304
2 SASI_Rn01_00125932 predicted 991
3 SASI_Rn01_00125933 predicted 5088
4 SASI_Rn01_00125934 predicted 5384
5 SASI_Rn01_00125935 predicted 591
6 SASI_Rn01_00125936 predicted 337
7 SASI_Rn01_00125937 predicted 5089
8 SASI_Rn01_00125938 predicted 5694
9 SASI_Rn01_00125939 predicted 533
10 SASI_Rn01_00125940 predicted 462
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029456 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095211 predicted 1907
2 SASI_Mm01_00095213 predicted 1119
3 SASI_Mm01_00095214 predicted 659
4 SASI_Mm01_00095215 predicted 1954
5 SASI_Mm01_00095216 predicted 245
6 SASI_Mm01_00095218 predicted 1603
7 SASI_Mm01_00095219 predicted 401
8 SASI_Mm02_00335376 predicted 1059
9 SASI_Mm02_00335377 predicted 2205
10 SASI_Mm02_00335378 predicted 2515
11 SASI_Mm01_00095212 predicted 1547
12 SASI_Mm01_00095217 predicted 727
13 SASI_Mm01_00095220 predicted 1311
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018312
PPP6R3 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 6, regulatory subunit 3
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018312.2-2637s1c1
Sequence:CCGGCTTCAGTGAATGGCCCTGTATCTCGAGATACAGGGCCATTCACTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018312.2-1781s1c1
Sequence:CCGGCGAGTATCAGACATCAACTTTCTCGAGAAAGTTGATGTCTGATACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018312.2-1010s1c1
Sequence:CCGGCAAGAAATTATAGAGCAGCTTCTCGAGAAGCTGCTCTATAATTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018312.2-652s1c1
Sequence:CCGGCAAGGTGCTAAGTATTCTTATCTCGAGATAAGAATACTTAGCACCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018312.4-2331s21c1
Sequence:CCGGAGATTCTTTAAGGAGTAATTCCTCGAGGAATTACTCCTTAAAGAATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018312.4-1201s21c1
Sequence:CCGGGAGACACGACGACCAACATTTCTCGAGAAATGTTGGTCGTCGTGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018312.4-1773s21c1
Sequence:CCGGTGATTATCAGATGCAACAAATCTCGAGATTTGTTGCATCTGATAATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018312.4-2174s21c1
Sequence:CCGGCCAACTGGTCAGCTAACTTTGCTCGAGCAAAGTTAGCTGACCAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018312.2-439s1c1
Sequence:CCGGCGAAGATTTAGTCTCATTCATCTCGAGATGAATGAGACTAAATCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018312.2-353s1c1
Sequence:CCGGGAGTTAATGGATGAGGAAGATCTCGAGATCTTCCTCATCCATTAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018312.2-1162s1c1
Sequence:CCGGCCATTCAGCTTGTTCAGTAAACTCGAGTTTACTGAACAAGCTGAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018312.2-1431s1c1
Sequence:CCGGGAATACTTGAAGCCTGGGAAACTCGAGTTTCCCAGGCTTCAAGTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018312.2-2384s1c1
Sequence:CCGGGCAGAAAGTACAGACAAGGTACTCGAGTACCTTGTCTGTACTTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018312.2-882s1c1
Sequence:CCGGCGCAAGAAGAAGATCGACATTCTCGAGAATGTCGATCTTCTTCTTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018312
PPP6R3 MISSION shRNA shRNA Plasmid DNA
protein phosphatase 6, regulatory subunit 3
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018312.2-2637s1c1
Sequence:CCGGCTTCAGTGAATGGCCCTGTATCTCGAGATACAGGGCCATTCACTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018312.2-1781s1c1
Sequence:CCGGCGAGTATCAGACATCAACTTTCTCGAGAAAGTTGATGTCTGATACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018312.2-1010s1c1
Sequence:CCGGCAAGAAATTATAGAGCAGCTTCTCGAGAAGCTGCTCTATAATTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018312.2-652s1c1
Sequence:CCGGCAAGGTGCTAAGTATTCTTATCTCGAGATAAGAATACTTAGCACCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018312.4-2331s21c1
Sequence:CCGGAGATTCTTTAAGGAGTAATTCCTCGAGGAATTACTCCTTAAAGAATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018312.4-1201s21c1
Sequence:CCGGGAGACACGACGACCAACATTTCTCGAGAAATGTTGGTCGTCGTGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018312.4-1773s21c1
Sequence:CCGGTGATTATCAGATGCAACAAATCTCGAGATTTGTTGCATCTGATAATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018312.4-2174s21c1
Sequence:CCGGCCAACTGGTCAGCTAACTTTGCTCGAGCAAAGTTAGCTGACCAGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018312.2-439s1c1
Sequence:CCGGCGAAGATTTAGTCTCATTCATCTCGAGATGAATGAGACTAAATCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018312.2-353s1c1
Sequence:CCGGGAGTTAATGGATGAGGAAGATCTCGAGATCTTCCTCATCCATTAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018312.2-1162s1c1
Sequence:CCGGCCATTCAGCTTGTTCAGTAAACTCGAGTTTACTGAACAAGCTGAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018312.2-1431s1c1
Sequence:CCGGGAATACTTGAAGCCTGGGAAACTCGAGTTTCCCAGGCTTCAAGTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018312.2-2384s1c1
Sequence:CCGGGCAGAAAGTACAGACAAGGTACTCGAGTACCTTGTCTGTACTTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018312.2-882s1c1
Sequence:CCGGCGCAAGAAGAAGATCGACATTCTCGAGAATGTCGATCTTCTTCTTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018312
PPP6R3 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 6, regulatory subunit 3
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018312.2-2637s1c1
Sequence:CCGGCTTCAGTGAATGGCCCTGTATCTCGAGATACAGGGCCATTCACTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018312.2-1781s1c1
Sequence:CCGGCGAGTATCAGACATCAACTTTCTCGAGAAAGTTGATGTCTGATACTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018312.2-1010s1c1
Sequence:CCGGCAAGAAATTATAGAGCAGCTTCTCGAGAAGCTGCTCTATAATTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018312.2-652s1c1
Sequence:CCGGCAAGGTGCTAAGTATTCTTATCTCGAGATAAGAATACTTAGCACCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018312.4-2331s21c1
Sequence:CCGGAGATTCTTTAAGGAGTAATTCCTCGAGGAATTACTCCTTAAAGAATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018312.4-1201s21c1
Sequence:CCGGGAGACACGACGACCAACATTTCTCGAGAAATGTTGGTCGTCGTGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018312.4-1773s21c1
Sequence:CCGGTGATTATCAGATGCAACAAATCTCGAGATTTGTTGCATCTGATAATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018312.4-2174s21c1
Sequence:CCGGCCAACTGGTCAGCTAACTTTGCTCGAGCAAAGTTAGCTGACCAGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018312.2-439s1c1
Sequence:CCGGCGAAGATTTAGTCTCATTCATCTCGAGATGAATGAGACTAAATCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018312.2-353s1c1
Sequence:CCGGGAGTTAATGGATGAGGAAGATCTCGAGATCTTCCTCATCCATTAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018312.2-1162s1c1
Sequence:CCGGCCATTCAGCTTGTTCAGTAAACTCGAGTTTACTGAACAAGCTGAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018312.2-1431s1c1
Sequence:CCGGGAATACTTGAAGCCTGGGAAACTCGAGTTTCCCAGGCTTCAAGTATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018312.2-2384s1c1
Sequence:CCGGGCAGAAAGTACAGACAAGGTACTCGAGTACCTTGTCTGTACTTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018312.2-882s1c1
Sequence:CCGGCGCAAGAAGAAGATCGACATTCTCGAGAATGTCGATCTTCTTCTTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029456
VALIDATED
PPP6R3 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 6, regulatory subunit 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029456.1-371s1c1
Sequence:CCGGGCAAGCTCATAGAATTTCTGTCTCGAGACAGAAATTCTATGAGCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029456.1-463s21c1
Sequence:CCGGATCCGATACAAGTATCCAAATCTCGAGATTTGGATACTTGTATCGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029456.1-3420s1c1
Sequence:CCGGGCTACAACTTAGTTGATGAATCTCGAGATTCATCAACTAAGTTGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029456.1-877s1c1
Sequence:CCGGGCCTCACAATCACTTTGTGAACTCGAGTTCACAAAGTGATTGTGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029456.1-1352s21c1
Sequence:CCGGTGAACAGCATTGGCGTCATATCTCGAGATATGACGCCAATGCTGTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029456.1-3640s21c1
Sequence:CCGGAGTATCACTGATGGCTATTTCCTCGAGGAAATAGCCATCAGTGATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029456.1-1800s21c1
Sequence:CCGGTGATTATCAGATGCAACAAATCTCGAGATTTGTTGCATCTGATAATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029456.1-787s21c1
Sequence:CCGGGATGTTCTGAATTGGCTAAATCTCGAGATTTAGCCAATTCAGAACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029456
VALIDATED
PPP6R3 MISSION shRNA shRNA Plasmid DNA
protein phosphatase 6, regulatory subunit 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029456.1-371s1c1
Sequence:CCGGGCAAGCTCATAGAATTTCTGTCTCGAGACAGAAATTCTATGAGCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029456.1-463s21c1
Sequence:CCGGATCCGATACAAGTATCCAAATCTCGAGATTTGGATACTTGTATCGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029456.1-3420s1c1
Sequence:CCGGGCTACAACTTAGTTGATGAATCTCGAGATTCATCAACTAAGTTGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029456.1-877s1c1
Sequence:CCGGGCCTCACAATCACTTTGTGAACTCGAGTTCACAAAGTGATTGTGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029456.1-1352s21c1
Sequence:CCGGTGAACAGCATTGGCGTCATATCTCGAGATATGACGCCAATGCTGTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029456.1-3640s21c1
Sequence:CCGGAGTATCACTGATGGCTATTTCCTCGAGGAAATAGCCATCAGTGATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029456.1-1800s21c1
Sequence:CCGGTGATTATCAGATGCAACAAATCTCGAGATTTGTTGCATCTGATAATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029456.1-787s21c1
Sequence:CCGGGATGTTCTGAATTGGCTAAATCTCGAGATTTAGCCAATTCAGAACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029456
VALIDATED
PPP6R3 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 6, regulatory subunit 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029456.1-371s1c1
Sequence:CCGGGCAAGCTCATAGAATTTCTGTCTCGAGACAGAAATTCTATGAGCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029456.1-463s21c1
Sequence:CCGGATCCGATACAAGTATCCAAATCTCGAGATTTGGATACTTGTATCGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029456.1-3420s1c1
Sequence:CCGGGCTACAACTTAGTTGATGAATCTCGAGATTCATCAACTAAGTTGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029456.1-877s1c1
Sequence:CCGGGCCTCACAATCACTTTGTGAACTCGAGTTCACAAAGTGATTGTGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029456.1-1352s21c1
Sequence:CCGGTGAACAGCATTGGCGTCATATCTCGAGATATGACGCCAATGCTGTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029456.1-3640s21c1
Sequence:CCGGAGTATCACTGATGGCTATTTCCTCGAGGAAATAGCCATCAGTGATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029456.1-1800s21c1
Sequence:CCGGTGATTATCAGATGCAACAAATCTCGAGATTTGTTGCATCTGATAATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029456.1-787s21c1
Sequence:CCGGGATGTTCTGAATTGGCTAAATCTCGAGATTTAGCCAATTCAGAACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)