EMAIL THIS PAGE TO A FRIEND

PPRC1

peroxisome proliferator-activated receptor gamma, coactivator-related 1

116 Gene Product Result for
Synonyms: PRC RP11-302K17.6
Gene ID:
Human(23082) Summary: The protein encoded by this gene is similar to PPAR-gamma coactivator 1 (PPARGC1/PGC-1), a protein that can activate mitochondrial biogenesis in part through a direct interaction with nuclear respiratory factor 1 (NRF1). This protein has been shown to interact with NRF1. It is thought to be a functional relative of PPARGC1 that activates mitochondrial biogenesis through NRF1 in response to proliferative signals. [provided by RefSeq, Jul 2008]
Mouse(226169) peroxisome proliferative activated receptor, gamma, coactivator-related 1
Rat(294007) peroxisome proliferator-activated receptor gamma, coactivator-related 1
Zebrafish(100002463) peroxisome proliferator-activated receptor gamma, coactivator-related 1
dog(477805) peroxisome proliferator-activated receptor gamma, coactivator-related 1
Horse(100060142) peroxisome proliferator-activated receptor gamma, coactivator-related 1
domestic cat(101100597) peroxisome proliferator-activated receptor gamma, coactivator-related 1
chicken(423848) peroxisome proliferator-activated receptor gamma, coactivator-related 1
cow(513279) peroxisome proliferator-activated receptor gamma, coactivator-related 1
sheep(101106218) peroxisome proliferator-activated receptor gamma, coactivator-related 1
domestic guinea pig(100720546) peroxisome proliferator-activated receptor gamma, coactivator-related 1
naked mole-rat(101707931) peroxisome proliferator-activated receptor gamma, coactivator-related 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015062 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015062 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015062 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081214 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081214 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081214 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU130501 MISSION® esiRNA esiRNA human PPRC1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015062 Rosetta Predictions human pricing
NM_001106363 Rosetta Predictions rat pricing
NM_001081214 Rosetta Predictions mouse pricing
XM_001003210 Rosetta Predictions mouse pricing
XM_358330 Rosetta Predictions mouse pricing
XM_901843 Rosetta Predictions mouse pricing
XM_901845 Rosetta Predictions mouse pricing
XM_901848 Rosetta Predictions mouse pricing
XM_901850 Rosetta Predictions mouse pricing
XM_901854 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015062 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155299 predicted 3326
2 SASI_Hs01_00155300 predicted 3193
3 SASI_Hs01_00155301 predicted 331
4 SASI_Hs01_00155302 predicted 4230
5 SASI_Hs01_00155303 predicted 3333
6 SASI_Hs01_00155304 predicted 210
7 SASI_Hs01_00155305 predicted 3993
8 SASI_Hs01_00155306 predicted 1670
9 SASI_Hs01_00155307 predicted 1402
10 SASI_Hs01_00155308 predicted 2211
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106363 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218228 predicted 3734
2 SASI_Rn02_00218229 predicted 2860
3 SASI_Rn02_00218230 predicted 4186
4 SASI_Rn02_00218231 predicted 2612
5 SASI_Rn02_00218232 predicted 4888
6 SASI_Rn02_00218233 predicted 4671
7 SASI_Rn02_00218234 predicted 1637
8 SASI_Rn02_00218235 predicted 344
9 SASI_Rn02_00218236 predicted 4845
10 SASI_Rn02_00218237 predicted 812
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081214 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296301 predicted 4747
2 SASI_Mm02_00296302 predicted 3225
3 SASI_Mm02_00296303 predicted 3955
4 SASI_Mm02_00296304 predicted 1303
5 SASI_Mm02_00296305 predicted 345
6 SASI_Mm02_00296306 predicted 2495
7 SASI_Mm02_00296307 predicted 3317
8 SASI_Mm02_00296308 predicted 3275
9 SASI_Mm02_00296309 predicted 3979
10 SASI_Mm02_00296310 predicted 4937
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003210 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00282393 predicted 3283
2 SASI_Mm01_00282394 predicted 3342
3 SASI_Mm01_00282395 predicted 3240
4 SASI_Mm01_00282396 predicted 3729
5 SASI_Mm01_00282397 predicted 3249
6 SASI_Mm01_00282398 predicted 3527
7 SASI_Mm01_00282399 predicted 3325
8 SASI_Mm01_00282400 predicted 3492
9 SASI_Mm01_00282401 predicted 3640
10 SASI_Mm01_00282402 predicted 3605
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_358330 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00236905 predicted 3340
2 SASI_Mm01_00236906 predicted 4877
3 SASI_Mm01_00236907 predicted 3232
4 SASI_Mm01_00236908 predicted 3248
5 SASI_Mm01_00236909 predicted 3515
6 SASI_Mm01_00236910 predicted 4883
7 SASI_Mm01_00236911 predicted 3329
8 SASI_Mm01_00236912 predicted 3281
9 SASI_Mm01_00236913 predicted 3485
10 SASI_Mm01_00236914 predicted 4869
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901843 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00255775 predicted 4457
2 SASI_Mm01_00255776 predicted 4399
3 SASI_Mm01_00255777 predicted 4492
4 SASI_Mm01_00255778 predicted 4510
5 SASI_Mm01_00255779 predicted 4402
6 SASI_Mm01_00255780 predicted 4466
7 SASI_Mm01_00255781 predicted 4490
8 SASI_Mm01_00255782 predicted 4436
9 SASI_Mm01_00255783 predicted 4449
10 SASI_Mm01_00255784 predicted 4438
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901845 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201838 predicted 205
2 SASI_Mm01_00201839 predicted 323
3 SASI_Mm01_00201840 predicted 202
4 SASI_Mm01_00201841 predicted 378
5 SASI_Mm01_00201842 predicted 430
6 SASI_Mm01_00201843 predicted 420
7 SASI_Mm01_00201844 predicted 331
8 SASI_Mm01_00201845 predicted 390
9 SASI_Mm01_00201846 predicted 240
10 SASI_Mm01_00201847 predicted 372
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901848 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00282978 predicted 3281
2 SASI_Mm01_00282979 predicted 3346
3 SASI_Mm01_00282980 predicted 3231
4 SASI_Mm01_00282981 predicted 3735
5 SASI_Mm01_00282982 predicted 3251
6 SASI_Mm01_00282983 predicted 3528
7 SASI_Mm01_00282984 predicted 3322
8 SASI_Mm01_00282985 predicted 3495
9 SASI_Mm01_00282986 predicted 3635
10 SASI_Mm01_00282987 predicted 3600
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901850 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00235123 predicted 1446
2 SASI_Mm01_00235124 predicted 1386
3 SASI_Mm01_00235125 predicted 1488
4 SASI_Mm01_00235126 predicted 1497
5 SASI_Mm01_00235127 predicted 1391
6 SASI_Mm01_00235128 predicted 1459
7 SASI_Mm01_00235129 predicted 1481
8 SASI_Mm01_00235130 predicted 1428
9 SASI_Mm01_00235131 predicted 1442
10 SASI_Mm01_00235132 predicted 1423
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901854 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00227169 predicted 2397
2 SASI_Mm01_00227170 predicted 1332
3 SASI_Mm01_00227171 predicted 3225
4 SASI_Mm01_00227172 predicted 1298
5 SASI_Mm01_00227173 predicted 3236
6 SASI_Mm01_00227174 predicted 2610
7 SASI_Mm01_00227175 predicted 278
8 SASI_Mm01_00227176 predicted 346
9 SASI_Mm01_00227177 predicted 2486
10 SASI_Mm01_00227178 predicted 3320
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015062
VALIDATED
PPRC1 MISSION shRNA Bacterial Glycerol Stock
peroxisome proliferator-activated receptor gamma, coactivator-related 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015062.3-3962s21c1
Sequence:CCGGAGATGCCTGCCCTAGTCATTCCTCGAGGAATGACTAGGGCAGGCATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417601    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015062.3-5040s21c1
Sequence:CCGGGGCCCTTCCCTGCTATCCTTTCTCGAGAAAGGATAGCAGGGAAGGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015062.3-2737s21c1
Sequence:CCGGCCTAGTCTTCCATTGTCTATGCTCGAGCATAGACAATGGAAGACTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015062.3-4599s21c1
Sequence:CCGGTTATCGTTCACATGACCATTACTCGAGTAATGGTCATGTGAACGATAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015062.3-2079s21c1
Sequence:CCGGAGTTGACCCAGTGCTAGTTAACTCGAGTTAACTAGCACTGGGTCAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015062.3-2762s21c1
Sequence:CCGGCAGTACTACCTGATCCGTTTACTCGAGTAAACGGATCAGGTAGTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015062.3-2770s1c1
Sequence:CCGGCCTGATCCGTTTACTCACTATCTCGAGATAGTGAGTAAACGGATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015062.3-2032s1c1
Sequence:CCGGCCAGTTGATCTAGCACTGGTTCTCGAGAACCAGTGCTAGATCAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015062.3-4957s1c1
Sequence:CCGGGCACCTGTAAAGAGCAAATTTCTCGAGAAATTTGCTCTTTACAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015062.3-1723s1c1
Sequence:CCGGGCTGACACTATCCAAACCAATCTCGAGATTGGTTTGGATAGTGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015062.3-674s1c1
Sequence:CCGGCCTCTTTCTTAGAGACCTCTTCTCGAGAAGAGGTCTCTAAGAAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015062
VALIDATED
PPRC1 MISSION shRNA shRNA Plasmid DNA
peroxisome proliferator-activated receptor gamma, coactivator-related 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015062.3-3962s21c1
Sequence:CCGGAGATGCCTGCCCTAGTCATTCCTCGAGGAATGACTAGGGCAGGCATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417601    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015062.3-5040s21c1
Sequence:CCGGGGCCCTTCCCTGCTATCCTTTCTCGAGAAAGGATAGCAGGGAAGGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015062.3-2737s21c1
Sequence:CCGGCCTAGTCTTCCATTGTCTATGCTCGAGCATAGACAATGGAAGACTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015062.3-4599s21c1
Sequence:CCGGTTATCGTTCACATGACCATTACTCGAGTAATGGTCATGTGAACGATAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015062.3-2079s21c1
Sequence:CCGGAGTTGACCCAGTGCTAGTTAACTCGAGTTAACTAGCACTGGGTCAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015062.3-2762s21c1
Sequence:CCGGCAGTACTACCTGATCCGTTTACTCGAGTAAACGGATCAGGTAGTACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015062.3-2770s1c1
Sequence:CCGGCCTGATCCGTTTACTCACTATCTCGAGATAGTGAGTAAACGGATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015062.3-2032s1c1
Sequence:CCGGCCAGTTGATCTAGCACTGGTTCTCGAGAACCAGTGCTAGATCAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015062.3-4957s1c1
Sequence:CCGGGCACCTGTAAAGAGCAAATTTCTCGAGAAATTTGCTCTTTACAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015062.3-1723s1c1
Sequence:CCGGGCTGACACTATCCAAACCAATCTCGAGATTGGTTTGGATAGTGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015062.3-674s1c1
Sequence:CCGGCCTCTTTCTTAGAGACCTCTTCTCGAGAAGAGGTCTCTAAGAAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015062
VALIDATED
PPRC1 MISSION shRNA Lentiviral Transduction Particles
peroxisome proliferator-activated receptor gamma, coactivator-related 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015062.3-3962s21c1
Sequence:CCGGAGATGCCTGCCCTAGTCATTCCTCGAGGAATGACTAGGGCAGGCATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417601    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015062.3-5040s21c1
Sequence:CCGGGGCCCTTCCCTGCTATCCTTTCTCGAGAAAGGATAGCAGGGAAGGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015062.3-2737s21c1
Sequence:CCGGCCTAGTCTTCCATTGTCTATGCTCGAGCATAGACAATGGAAGACTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015062.3-4599s21c1
Sequence:CCGGTTATCGTTCACATGACCATTACTCGAGTAATGGTCATGTGAACGATAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015062.3-2079s21c1
Sequence:CCGGAGTTGACCCAGTGCTAGTTAACTCGAGTTAACTAGCACTGGGTCAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015062.3-2762s21c1
Sequence:CCGGCAGTACTACCTGATCCGTTTACTCGAGTAAACGGATCAGGTAGTACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015062.3-2770s1c1
Sequence:CCGGCCTGATCCGTTTACTCACTATCTCGAGATAGTGAGTAAACGGATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015062.3-2032s1c1
Sequence:CCGGCCAGTTGATCTAGCACTGGTTCTCGAGAACCAGTGCTAGATCAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015062.3-4957s1c1
Sequence:CCGGGCACCTGTAAAGAGCAAATTTCTCGAGAAATTTGCTCTTTACAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015062.3-1723s1c1
Sequence:CCGGGCTGACACTATCCAAACCAATCTCGAGATTGGTTTGGATAGTGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015062.3-674s1c1
Sequence:CCGGCCTCTTTCTTAGAGACCTCTTCTCGAGAAGAGGTCTCTAAGAAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081214
VALIDATED
PPRC1 MISSION shRNA Bacterial Glycerol Stock
peroxisome proliferator-activated receptor gamma, coactivator-related 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238479    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081214.1-5061s21c1
Sequence:CCGGGGAGAGCTGCTAGTGTGGAAACTCGAGTTTCCACACTAGCAGCTCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081214.1-337s21c1
Sequence:CCGGCATGGACGCCTCCCTTATATCCTCGAGGATATAAGGGAGGCGTCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081214.1-4743s21c1
Sequence:CCGGGTTTCGTCACTTACCGTTATGCTCGAGCATAACGGTAAGTGACGAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081214.1-1933s21c1
Sequence:CCGGGGCTATTCCCACTTCGGATAACTCGAGTTATCCGAAGTGGGAATAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081214.1-2020s21c1
Sequence:CCGGAGCAGATCCTGTGCTAGTTAACTCGAGTTAACTAGCACAGGATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081214
VALIDATED
PPRC1 MISSION shRNA shRNA Plasmid DNA
peroxisome proliferator-activated receptor gamma, coactivator-related 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238479    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081214.1-5061s21c1
Sequence:CCGGGGAGAGCTGCTAGTGTGGAAACTCGAGTTTCCACACTAGCAGCTCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081214.1-337s21c1
Sequence:CCGGCATGGACGCCTCCCTTATATCCTCGAGGATATAAGGGAGGCGTCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081214.1-4743s21c1
Sequence:CCGGGTTTCGTCACTTACCGTTATGCTCGAGCATAACGGTAAGTGACGAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081214.1-1933s21c1
Sequence:CCGGGGCTATTCCCACTTCGGATAACTCGAGTTATCCGAAGTGGGAATAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081214.1-2020s21c1
Sequence:CCGGAGCAGATCCTGTGCTAGTTAACTCGAGTTAACTAGCACAGGATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081214
VALIDATED
PPRC1 MISSION shRNA Lentiviral Transduction Particles
peroxisome proliferator-activated receptor gamma, coactivator-related 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238479    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081214.1-5061s21c1
Sequence:CCGGGGAGAGCTGCTAGTGTGGAAACTCGAGTTTCCACACTAGCAGCTCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081214.1-337s21c1
Sequence:CCGGCATGGACGCCTCCCTTATATCCTCGAGGATATAAGGGAGGCGTCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081214.1-4743s21c1
Sequence:CCGGGTTTCGTCACTTACCGTTATGCTCGAGCATAACGGTAAGTGACGAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081214.1-1933s21c1
Sequence:CCGGGGCTATTCCCACTTCGGATAACTCGAGTTATCCGAAGTGGGAATAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081214.1-2020s21c1
Sequence:CCGGAGCAGATCCTGTGCTAGTTAACTCGAGTTAACTAGCACAGGATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)