EMAIL THIS PAGE TO A FRIEND

PPTC7

PTC7 protein phosphatase homolog (S. cerevisiae)

193 Gene Product Result for
Synonyms: TA-PP2C TAPP2C
UniProtKB ID: Q8NI37, B3KWC5, Q68DZ7, Q6UY82
Gene ID:
Mouse(320717) PTC7 protein phosphatase homolog (S. cerevisiae)
Rat(304488) PTC7 protein phosphatase homolog (S. cerevisiae)
chicken(416869) PTC7 protein phosphatase homolog (S. cerevisiae)
domestic cat(101080741) PTC7 protein phosphatase homolog (S. cerevisiae)
dog(486265) PTC7 protein phosphatase homolog (S. cerevisiae)
naked mole-rat(101716465) PTC7 protein phosphatase homolog (S. cerevisiae)
domestic guinea pig(100718276) PTC7 protein phosphatase homolog (S. cerevisiae)
cow(525355) PTC7 protein phosphatase homolog (S. cerevisiae)
sheep(101105779) PTC7 protein phosphatase homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139283 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139283 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139283 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177242 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177242 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177242 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU078361 MISSION® esiRNA esiRNA targeting mouse Pptc7 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139283 Rosetta Predictions human pricing
NM_001107141 Rosetta Predictions rat pricing
NM_177242 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139283 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083800 predicted 1024
2 SASI_Hs01_00083801 predicted 558
3 SASI_Hs02_00364272 predicted 1047
4 SASI_Hs01_00083802 predicted 851
5 SASI_Hs01_00083803 predicted 561
6 SASI_Hs01_00083805 predicted 992
7 SASI_Hs01_00083806 predicted 1022
8 SASI_Hs01_00083807 predicted 1015
9 SASI_Hs01_00083808 predicted 1046
10 SASI_Hs01_00083809 predicted 1006
11 SASI_Hs01_00083804 predicted 1161
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107141 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225905 predicted 930
2 SASI_Rn02_00225906 predicted 1521
3 SASI_Rn02_00225907 predicted 979
4 SASI_Rn02_00225908 predicted 628
5 SASI_Rn02_00225909 predicted 1531
6 SASI_Rn02_00225910 predicted 1641
7 SASI_Rn02_00225911 predicted 807
8 SASI_Rn02_00225912 predicted 1161
9 SASI_Rn02_00225913 predicted 1543
10 SASI_Rn02_00225914 predicted 818
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177242 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175239 predicted 1501
2 SASI_Mm01_00175240 predicted 1337
3 SASI_Mm01_00175241 predicted 1104
4 SASI_Mm01_00175242 predicted 1521
5 SASI_Mm01_00175243 predicted 623
6 SASI_Mm01_00175244 predicted 1685
7 SASI_Mm01_00175245 predicted 1539
8 SASI_Mm01_00175246 predicted 975
9 SASI_Mm01_00175247 predicted 1488
10 SASI_Mm01_00175248 predicted 1084
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139283
VALIDATED
PPTC7 MISSION shRNA Bacterial Glycerol Stock
PTC7 protein phosphatase homolog (S. cerevisiae)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_139283.x-759s1c1
Sequence:CCGGGCATTACTTCAACACTCCATTCTCGAGAATGGAGTGTTGAAGTAATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_139283.x-500s1c1
Sequence:CCGGCTCAATTCTCAGGGACTTTAACTCGAGTTAAAGTCCCTGAGAATTGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_139283.1-550s21c1
Sequence:CCGGGGACGGTTCGTACCTAGTAATCTCGAGATTACTAGGTACGAACCGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139283.1-1116s21c1
Sequence:CCGGTTCAATAGTGGCTGAGTATACCTCGAGGTATACTCAGCCACTATTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002705    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_139283.x-1220s1c1
Sequence:CCGGCCACATTTCTTTGCCACTGATCTCGAGATCAGTGGCAAAGAAATGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139283.x-1025s1c1
Sequence:CCGGACCCAAATTATATGTCACCTTCTCGAGAAGGTGACATATAATTTGGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139283.1-838s21c1
Sequence:GTACCGGGCTGCTGATAGCACGTCTTTCCTCGAGGAAAGACGTGCTATCAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139283.x-872s1c1
Sequence:CCGGGAGACATTATCCTGACGGCAACTCGAGTTGCCGTCAGGATAATGTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139283.1-862s21c1
Sequence:GTACCGGGTCCAGCTAGGAGACATTATCCTCGAGGATAATGTCTCCTAGCTGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315121    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_139283.1-1220s21c1
Sequence:CCGGCCACATTTCTTTGCCACTGATCTCGAGATCAGTGGCAAAGAAATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_139283.1-905s21c1
Sequence:CCGGTTGACAACATGCCTGATTATACTCGAGTATAATCAGGCATGTTGTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_139283.1-500s21c1
Sequence:CCGGCTCAATTCTCAGGGACTTTAACTCGAGTTAAAGTCCCTGAGAATTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139283.1-1012s21c1
Sequence:GTACCGGGAGCTGGCCTATGACCCAAATCTCGAGATTTGGGTCATAGGCCAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139283
VALIDATED
PPTC7 MISSION shRNA shRNA Plasmid DNA
PTC7 protein phosphatase homolog (S. cerevisiae)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_139283.x-759s1c1
Sequence:CCGGGCATTACTTCAACACTCCATTCTCGAGAATGGAGTGTTGAAGTAATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_139283.x-500s1c1
Sequence:CCGGCTCAATTCTCAGGGACTTTAACTCGAGTTAAAGTCCCTGAGAATTGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_139283.1-550s21c1
Sequence:CCGGGGACGGTTCGTACCTAGTAATCTCGAGATTACTAGGTACGAACCGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139283.1-1116s21c1
Sequence:CCGGTTCAATAGTGGCTGAGTATACCTCGAGGTATACTCAGCCACTATTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002705    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_139283.x-1220s1c1
Sequence:CCGGCCACATTTCTTTGCCACTGATCTCGAGATCAGTGGCAAAGAAATGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139283.x-1025s1c1
Sequence:CCGGACCCAAATTATATGTCACCTTCTCGAGAAGGTGACATATAATTTGGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139283.1-838s21c1
Sequence:GTACCGGGCTGCTGATAGCACGTCTTTCCTCGAGGAAAGACGTGCTATCAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139283.x-872s1c1
Sequence:CCGGGAGACATTATCCTGACGGCAACTCGAGTTGCCGTCAGGATAATGTCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139283.1-862s21c1
Sequence:GTACCGGGTCCAGCTAGGAGACATTATCCTCGAGGATAATGTCTCCTAGCTGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315121    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_139283.1-1220s21c1
Sequence:CCGGCCACATTTCTTTGCCACTGATCTCGAGATCAGTGGCAAAGAAATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_139283.1-905s21c1
Sequence:CCGGTTGACAACATGCCTGATTATACTCGAGTATAATCAGGCATGTTGTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_139283.1-500s21c1
Sequence:CCGGCTCAATTCTCAGGGACTTTAACTCGAGTTAAAGTCCCTGAGAATTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139283.1-1012s21c1
Sequence:GTACCGGGAGCTGGCCTATGACCCAAATCTCGAGATTTGGGTCATAGGCCAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139283
VALIDATED
PPTC7 MISSION shRNA Lentiviral Transduction Particles
PTC7 protein phosphatase homolog (S. cerevisiae)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_139283.x-759s1c1
Sequence:CCGGGCATTACTTCAACACTCCATTCTCGAGAATGGAGTGTTGAAGTAATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_139283.x-500s1c1
Sequence:CCGGCTCAATTCTCAGGGACTTTAACTCGAGTTAAAGTCCCTGAGAATTGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_139283.1-550s21c1
Sequence:CCGGGGACGGTTCGTACCTAGTAATCTCGAGATTACTAGGTACGAACCGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139283.1-1116s21c1
Sequence:CCGGTTCAATAGTGGCTGAGTATACCTCGAGGTATACTCAGCCACTATTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002705    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_139283.x-1220s1c1
Sequence:CCGGCCACATTTCTTTGCCACTGATCTCGAGATCAGTGGCAAAGAAATGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139283.x-1025s1c1
Sequence:CCGGACCCAAATTATATGTCACCTTCTCGAGAAGGTGACATATAATTTGGGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139283.1-838s21c1
Sequence:GTACCGGGCTGCTGATAGCACGTCTTTCCTCGAGGAAAGACGTGCTATCAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139283.x-872s1c1
Sequence:CCGGGAGACATTATCCTGACGGCAACTCGAGTTGCCGTCAGGATAATGTCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139283.1-862s21c1
Sequence:GTACCGGGTCCAGCTAGGAGACATTATCCTCGAGGATAATGTCTCCTAGCTGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315121    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_139283.1-1220s21c1
Sequence:CCGGCCACATTTCTTTGCCACTGATCTCGAGATCAGTGGCAAAGAAATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_139283.1-905s21c1
Sequence:CCGGTTGACAACATGCCTGATTATACTCGAGTATAATCAGGCATGTTGTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_139283.1-500s21c1
Sequence:CCGGCTCAATTCTCAGGGACTTTAACTCGAGTTAAAGTCCCTGAGAATTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139283.1-1012s21c1
Sequence:GTACCGGGAGCTGGCCTATGACCCAAATCTCGAGATTTGGGTCATAGGCCAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177242
VALIDATED
PPTC7 MISSION shRNA Bacterial Glycerol Stock
PTC7 protein phosphatase homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177242.3-820s1c1
Sequence:CCGGGCACTACTTCAACACTCCATTCTCGAGAATGGAGTGTTGAAGTAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177242.3-898s1c1
Sequence:CCGGCGCTGCTGATAGCACATCTTTCTCGAGAAAGATGTGCTATCAGCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177242.3-1075s1c1
Sequence:CCGGGCTGGCCTATGACCCAAATTACTCGAGTAATTTGGGTCATAGGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177242.3-1087s1c1
Sequence:CCGGCCCAAATTATATGTCACCTTTCTCGAGAAAGGTGACATATAATTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080893    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177242.3-3103s1c1
Sequence:CCGGCCGACATTTAATTCCTGCTAACTCGAGTTAGCAGGAATTAAATGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177242.4-820s21c1
Sequence:CCGGGCACTACTTCAACACTCCATTCTCGAGAATGGAGTGTTGAAGTAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177242.4-3103s21c1
Sequence:CCGGCCGACATTTAATTCCTGCTAACTCGAGTTAGCAGGAATTAAATGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177242.4-898s21c1
Sequence:CCGGCGCTGCTGATAGCACATCTTTCTCGAGAAAGATGTGCTATCAGCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177242.4-1075s21c1
Sequence:CCGGGCTGGCCTATGACCCAAATTACTCGAGTAATTTGGGTCATAGGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177242
VALIDATED
PPTC7 MISSION shRNA shRNA Plasmid DNA
PTC7 protein phosphatase homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177242.3-820s1c1
Sequence:CCGGGCACTACTTCAACACTCCATTCTCGAGAATGGAGTGTTGAAGTAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177242.3-898s1c1
Sequence:CCGGCGCTGCTGATAGCACATCTTTCTCGAGAAAGATGTGCTATCAGCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177242.3-1075s1c1
Sequence:CCGGGCTGGCCTATGACCCAAATTACTCGAGTAATTTGGGTCATAGGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177242.3-1087s1c1
Sequence:CCGGCCCAAATTATATGTCACCTTTCTCGAGAAAGGTGACATATAATTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080893    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177242.3-3103s1c1
Sequence:CCGGCCGACATTTAATTCCTGCTAACTCGAGTTAGCAGGAATTAAATGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177242.4-820s21c1
Sequence:CCGGGCACTACTTCAACACTCCATTCTCGAGAATGGAGTGTTGAAGTAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177242.4-3103s21c1
Sequence:CCGGCCGACATTTAATTCCTGCTAACTCGAGTTAGCAGGAATTAAATGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177242.4-898s21c1
Sequence:CCGGCGCTGCTGATAGCACATCTTTCTCGAGAAAGATGTGCTATCAGCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177242.4-1075s21c1
Sequence:CCGGGCTGGCCTATGACCCAAATTACTCGAGTAATTTGGGTCATAGGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177242
VALIDATED
PPTC7 MISSION shRNA Lentiviral Transduction Particles
PTC7 protein phosphatase homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177242.3-820s1c1
Sequence:CCGGGCACTACTTCAACACTCCATTCTCGAGAATGGAGTGTTGAAGTAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177242.3-898s1c1
Sequence:CCGGCGCTGCTGATAGCACATCTTTCTCGAGAAAGATGTGCTATCAGCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177242.3-1075s1c1
Sequence:CCGGGCTGGCCTATGACCCAAATTACTCGAGTAATTTGGGTCATAGGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177242.3-1087s1c1
Sequence:CCGGCCCAAATTATATGTCACCTTTCTCGAGAAAGGTGACATATAATTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080893    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177242.3-3103s1c1
Sequence:CCGGCCGACATTTAATTCCTGCTAACTCGAGTTAGCAGGAATTAAATGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177242.4-820s21c1
Sequence:CCGGGCACTACTTCAACACTCCATTCTCGAGAATGGAGTGTTGAAGTAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177242.4-3103s21c1
Sequence:CCGGCCGACATTTAATTCCTGCTAACTCGAGTTAGCAGGAATTAAATGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177242.4-898s21c1
Sequence:CCGGCGCTGCTGATAGCACATCTTTCTCGAGAAAGATGTGCTATCAGCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177242.4-1075s21c1
Sequence:CCGGGCTGGCCTATGACCCAAATTACTCGAGTAATTTGGGTCATAGGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)