EMAIL THIS PAGE TO A FRIEND

PPWD1

peptidylprolyl isomerase domain and WD repeat containing 1

57 Gene Product Result for
UniProtKB ID: Q96BP3, Q15002, Q7KZ89
Gene ID:
Mouse(238831) peptidylprolyl isomerase domain and WD repeat containing 1
Rat(294711) peptidylprolyl isomerase domain and WD repeat containing 1
Zebrafish(100000660) peptidylprolyl isomerase domain and WD repeat containing 1
dog(478078) peptidylprolyl isomerase domain and WD repeat containing 1
Horse(100050595) peptidylprolyl isomerase domain and WD repeat containing 1
domestic cat(101081114) peptidylprolyl isomerase domain and WD repeat containing 1
chicken(427163) peptidylprolyl isomerase domain and WD repeat containing 1
domestic guinea pig(100727995) peptidylprolyl isomerase domain and WD repeat containing 1
naked mole-rat(101714350) peptidylprolyl isomerase domain and WD repeat containing 1
Domestic Rabbit(100356047) peptidylprolyl isomerase domain and WD repeat containing 1
cow(517560) peptidylprolyl isomerase domain and WD repeat containing 1
sheep(101103183) peptidylprolyl isomerase domain and WD repeat containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172807 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172807 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172807 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015342 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015342 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015342 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015342 Rosetta Predictions human pricing
NM_001106406 Rosetta Predictions rat pricing
NM_172807 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015342 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126494 predicted 635
2 SASI_Hs01_00126495 predicted 1504
3 SASI_Hs01_00126497 predicted 844
4 SASI_Hs01_00126498 predicted 1456
5 SASI_Hs01_00126499 predicted 959
6 SASI_Hs01_00126500 predicted 246
7 SASI_Hs01_00126501 predicted 1123
8 SASI_Hs02_00347648 predicted 948
9 SASI_Hs02_00347649 predicted 998
10 SASI_Hs01_00126503 predicted 320
11 SASI_Hs01_00126496 predicted 1053
12 SASI_Hs01_00126502 predicted 216
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106406 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218648 predicted 762
2 SASI_Rn02_00218649 predicted 744
3 SASI_Rn02_00218650 predicted 1098
4 SASI_Rn02_00218651 predicted 311
5 SASI_Rn02_00218652 predicted 1388
6 SASI_Rn02_00218653 predicted 1641
7 SASI_Rn02_00218654 predicted 378
8 SASI_Rn02_00218655 predicted 1246
9 SASI_Rn02_00218656 predicted 2048
10 SASI_Rn02_00218657 predicted 896
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172807 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192927 predicted 858
2 SASI_Mm01_00192928 predicted 219
3 SASI_Mm01_00192929 predicted 1158
4 SASI_Mm01_00192930 predicted 405
5 SASI_Mm01_00192931 predicted 262
6 SASI_Mm01_00192932 predicted 833
7 SASI_Mm01_00192933 predicted 288
8 SASI_Mm01_00192935 predicted 624
9 SASI_Mm01_00192936 predicted 1218
10 SASI_Mm02_00344731 predicted 1490
11 SASI_Mm01_00192934 predicted 990
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172807
VALIDATED
PPWD1 MISSION shRNA Bacterial Glycerol Stock
peptidylprolyl isomerase domain and WD repeat containing 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172807.4-1835s21c1
Sequence:CCGGCCAACGCCTTGGCTTGATAATCTCGAGATTATCAAGCCAAGGCGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172807.4-675s21c1
Sequence:CCGGATAACCAGCCACTTCATATTTCTCGAGAAATATGAAGTGGCTGGTTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172807.4-1902s21c1
Sequence:CCGGAGAGGATTTCTAACGTTAAAGCTCGAGCTTTAACGTTAGAAATCCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172807.4-989s21c1
Sequence:CCGGAGGGTCTTTGATGAATCATTACTCGAGTAATGATTCATCAAAGACCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101170    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172807.1-2178s1c1
Sequence:CCGGGCACTAAATTGAGGCAAATAACTCGAGTTATTTGCCTCAATTTAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172807.1-476s1c1
Sequence:CCGGCGGTGATGATAAAGCGATGAACTCGAGTTCATCGCTTTATCATCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172807.1-785s1c1
Sequence:CCGGGCACGAATATAAGTTCCCTAACTCGAGTTAGGGAACTTATATTCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172807.1-1148s1c1
Sequence:CCGGGCTGGGCATTAAAGTAATAAACTCGAGTTTATTACTTTAATGCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172807
VALIDATED
PPWD1 MISSION shRNA shRNA Plasmid DNA
peptidylprolyl isomerase domain and WD repeat containing 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172807.4-1835s21c1
Sequence:CCGGCCAACGCCTTGGCTTGATAATCTCGAGATTATCAAGCCAAGGCGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172807.4-675s21c1
Sequence:CCGGATAACCAGCCACTTCATATTTCTCGAGAAATATGAAGTGGCTGGTTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172807.4-1902s21c1
Sequence:CCGGAGAGGATTTCTAACGTTAAAGCTCGAGCTTTAACGTTAGAAATCCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172807.4-989s21c1
Sequence:CCGGAGGGTCTTTGATGAATCATTACTCGAGTAATGATTCATCAAAGACCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101170    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172807.1-2178s1c1
Sequence:CCGGGCACTAAATTGAGGCAAATAACTCGAGTTATTTGCCTCAATTTAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172807.1-476s1c1
Sequence:CCGGCGGTGATGATAAAGCGATGAACTCGAGTTCATCGCTTTATCATCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172807.1-785s1c1
Sequence:CCGGGCACGAATATAAGTTCCCTAACTCGAGTTAGGGAACTTATATTCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172807.1-1148s1c1
Sequence:CCGGGCTGGGCATTAAAGTAATAAACTCGAGTTTATTACTTTAATGCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172807
VALIDATED
PPWD1 MISSION shRNA Lentiviral Transduction Particles
peptidylprolyl isomerase domain and WD repeat containing 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172807.4-1835s21c1
Sequence:CCGGCCAACGCCTTGGCTTGATAATCTCGAGATTATCAAGCCAAGGCGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172807.4-675s21c1
Sequence:CCGGATAACCAGCCACTTCATATTTCTCGAGAAATATGAAGTGGCTGGTTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172807.4-1902s21c1
Sequence:CCGGAGAGGATTTCTAACGTTAAAGCTCGAGCTTTAACGTTAGAAATCCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172807.4-989s21c1
Sequence:CCGGAGGGTCTTTGATGAATCATTACTCGAGTAATGATTCATCAAAGACCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101170    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172807.1-2178s1c1
Sequence:CCGGGCACTAAATTGAGGCAAATAACTCGAGTTATTTGCCTCAATTTAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172807.1-476s1c1
Sequence:CCGGCGGTGATGATAAAGCGATGAACTCGAGTTCATCGCTTTATCATCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172807.1-785s1c1
Sequence:CCGGGCACGAATATAAGTTCCCTAACTCGAGTTAGGGAACTTATATTCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172807.1-1148s1c1
Sequence:CCGGGCTGGGCATTAAAGTAATAAACTCGAGTTTATTACTTTAATGCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015342
VALIDATED
PPWD1 MISSION shRNA Bacterial Glycerol Stock
peptidylprolyl isomerase domain and WD repeat containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000415117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015342.2-1597s21c1
Sequence:CCGGGCATACATTTCACCGTATAATCTCGAGATTATACGGTGAAATGTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015342.2-1459s21c1
Sequence:CCGGTGAAGGACCTAAACGAGTTTCCTCGAGGAAACTCGTTTAGGTCCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015342.2-540s21c1
Sequence:CCGGGACAGTGTGAGTGGATCTATTCTCGAGAATAGATCCACTCACACTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015342.2-1912s21c1
Sequence:CCGGTGAGGATGTCAGCATCATAAACTCGAGTTTATGATGCTGACATCCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015342.2-639s21c1
Sequence:CCGGATAACCAGCCACTTCATATTTCTCGAGAAATATGAAGTGGCTGGTTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015342.2-1799s21c1
Sequence:CCGGCCAACGCCTTGGCTTGATAATCTCGAGATTATCAAGCCAAGGCGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000165    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_015342.x-2013s1c1
Sequence:CCGGGCTTAGGACTTGCTGAATATACTCGAGTATATTCAGCAAGTCCTAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015342.x-399s1c1
Sequence:CCGGCCTGGGAGTTATTGAGAGTATCTCGAGATACTCTCAATAACTCCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015342.x-1358s1c1
Sequence:CCGGCCAAACGAGAACCAGAAGATACTCGAGTATCTTCTGGTTCTCGTTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_015342.x-509s1c1
Sequence:CCGGACATGCTGAAACTTGGCTATTCTCGAGAATAGCCAAGTTTCAGCATGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015342
VALIDATED
PPWD1 MISSION shRNA shRNA Plasmid DNA
peptidylprolyl isomerase domain and WD repeat containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000415117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015342.2-1597s21c1
Sequence:CCGGGCATACATTTCACCGTATAATCTCGAGATTATACGGTGAAATGTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015342.2-1459s21c1
Sequence:CCGGTGAAGGACCTAAACGAGTTTCCTCGAGGAAACTCGTTTAGGTCCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015342.2-540s21c1
Sequence:CCGGGACAGTGTGAGTGGATCTATTCTCGAGAATAGATCCACTCACACTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015342.2-1912s21c1
Sequence:CCGGTGAGGATGTCAGCATCATAAACTCGAGTTTATGATGCTGACATCCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015342.2-639s21c1
Sequence:CCGGATAACCAGCCACTTCATATTTCTCGAGAAATATGAAGTGGCTGGTTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015342.2-1799s21c1
Sequence:CCGGCCAACGCCTTGGCTTGATAATCTCGAGATTATCAAGCCAAGGCGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000165    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_015342.x-2013s1c1
Sequence:CCGGGCTTAGGACTTGCTGAATATACTCGAGTATATTCAGCAAGTCCTAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015342.x-399s1c1
Sequence:CCGGCCTGGGAGTTATTGAGAGTATCTCGAGATACTCTCAATAACTCCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015342.x-1358s1c1
Sequence:CCGGCCAAACGAGAACCAGAAGATACTCGAGTATCTTCTGGTTCTCGTTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_015342.x-509s1c1
Sequence:CCGGACATGCTGAAACTTGGCTATTCTCGAGAATAGCCAAGTTTCAGCATGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015342
VALIDATED
PPWD1 MISSION shRNA Lentiviral Transduction Particles
peptidylprolyl isomerase domain and WD repeat containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000415117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015342.2-1597s21c1
Sequence:CCGGGCATACATTTCACCGTATAATCTCGAGATTATACGGTGAAATGTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015342.2-1459s21c1
Sequence:CCGGTGAAGGACCTAAACGAGTTTCCTCGAGGAAACTCGTTTAGGTCCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015342.2-540s21c1
Sequence:CCGGGACAGTGTGAGTGGATCTATTCTCGAGAATAGATCCACTCACACTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015342.2-1912s21c1
Sequence:CCGGTGAGGATGTCAGCATCATAAACTCGAGTTTATGATGCTGACATCCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015342.2-639s21c1
Sequence:CCGGATAACCAGCCACTTCATATTTCTCGAGAAATATGAAGTGGCTGGTTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015342.2-1799s21c1
Sequence:CCGGCCAACGCCTTGGCTTGATAATCTCGAGATTATCAAGCCAAGGCGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000165    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_015342.x-2013s1c1
Sequence:CCGGGCTTAGGACTTGCTGAATATACTCGAGTATATTCAGCAAGTCCTAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015342.x-399s1c1
Sequence:CCGGCCTGGGAGTTATTGAGAGTATCTCGAGATACTCTCAATAACTCCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015342.x-1358s1c1
Sequence:CCGGCCAAACGAGAACCAGAAGATACTCGAGTATCTTCTGGTTCTCGTTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_015342.x-509s1c1
Sequence:CCGGACATGCTGAAACTTGGCTATTCTCGAGAATAGCCAAGTTTCAGCATGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)