EMAIL THIS PAGE TO A FRIEND

PPY

pancreatic polypeptide

47 Gene Product Result for
Synonyms: PNP
UniProtKB ID: P01298
Gene ID:
Human(5539) Summary: This gene belongs to the NPY family and it encodes a protein that is synthesized as a 95 aa polypeptide precursor in the pancreatic islets of Langerhans. It is cleaved into two peptide products; the active hormone of 36 aa and an icosapeptide of unknown function. The hormone acts as a regulator of pancreatic and gastrointestinal functions and may be important in the regulation of food intake. Plasma level of this hormone has been shown to be reduced in conditions associated with increased food intake and elevated in anorexia nervosa. In addition, infusion of this hormone in obese rodents has shown to decrease weight gain. [provided by RefSeq, Jul 2008]
Mouse(19064) pancreatic polypeptide
Rat(24677) pancreatic polypeptide
chicken(395564) pancreatic polypeptide
dog(490944) pancreatic polypeptide
domestic cat(101096772) pancreatic polypeptide
cow(280900) pancreatic polypeptide
sheep(443280) pancreatic polypeptide
naked mole-rat(101726209) pancreatic polypeptide
domestic guinea pig(100135605) pancreatic polypeptide
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0725 Human PPY / Pancreatic Prohormone ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008918 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008918 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008918 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002722 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002722 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002722 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU139581 MISSION® esiRNA esiRNA human PPY (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002722 Rosetta Predictions human pricing
NM_012626 Rosetta Predictions rat pricing
NM_008918 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002722 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227349 predicted 222
2 SASI_Hs01_00227350 predicted 213
3 SASI_Hs01_00227351 predicted 212
4 SASI_Hs01_00227352 predicted 223
5 SASI_Hs01_00227353 predicted 224
6 SASI_Hs01_00227354 predicted 173
7 SASI_Hs01_00227355 predicted 84
8 SASI_Hs01_00227356 predicted 335
9 SASI_Hs01_00227357 predicted 91
10 SASI_Hs01_00227358 predicted 181
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012626 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056278 predicted 210
2 SASI_Rn01_00056279 predicted 205
3 SASI_Rn01_00056280 predicted 229
4 SASI_Rn02_00259839 predicted 205
5 SASI_Rn01_00056283 predicted 200
6 SASI_Rn01_00056284 predicted 207
7 SASI_Rn01_00056285 predicted 227
8 SASI_Rn01_00056286 predicted 211
9 SASI_Rn01_00056287 predicted 220
10 SASI_Rn02_00259840 predicted 229
11 SASI_Rn01_00056281 predicted 262
12 SASI_Rn01_00056282 predicted 237
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008918 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026777 predicted 218
2 SASI_Mm01_00026779 predicted 249
3 SASI_Mm01_00026780 predicted 208
4 SASI_Mm01_00026781 predicted 211
5 SASI_Mm01_00026782 predicted 208
6 SASI_Mm01_00026784 predicted 244
7 SASI_Mm01_00026785 predicted 209
8 SASI_Mm01_00026786 predicted 181
9 SASI_Mm02_00314952 predicted 161
10 SASI_Mm02_00314953 predicted 160
11 SASI_Mm01_00026778 predicted 216
12 SASI_Mm01_00026783 predicted 221
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008918
PPY MISSION shRNA Bacterial Glycerol Stock
pancreatic polypeptide
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008918.1-196s1c1
Sequence:CCGGGCAGATACATCAACACACTGACTCGAGTCAGTGTGTTGATGTATCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008918.1-162s1c1
Sequence:CCGGCCTGAGCAGATGGCACAATATCTCGAGATATTGTGCCATCTGCTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008918.1-65s1c1
Sequence:CCGGGTTTCTCGTATCCACTTGGGTCTCGAGACCCAAGTGGATACGAGAAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008918.1-134s1c1
Sequence:CCGGGCCAATGTACCCAGGCGACTACTCGAGTAGTCGCCTGGGTACATTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008918.1-246s1c1
Sequence:CCGGGAGGAGAACACAGGTGGACTTCTCGAGAAGTCCACCTGTGTTCTCCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008918
PPY MISSION shRNA shRNA Plasmid DNA
pancreatic polypeptide
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008918.1-196s1c1
Sequence:CCGGGCAGATACATCAACACACTGACTCGAGTCAGTGTGTTGATGTATCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008918.1-162s1c1
Sequence:CCGGCCTGAGCAGATGGCACAATATCTCGAGATATTGTGCCATCTGCTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008918.1-65s1c1
Sequence:CCGGGTTTCTCGTATCCACTTGGGTCTCGAGACCCAAGTGGATACGAGAAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008918.1-134s1c1
Sequence:CCGGGCCAATGTACCCAGGCGACTACTCGAGTAGTCGCCTGGGTACATTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008918.1-246s1c1
Sequence:CCGGGAGGAGAACACAGGTGGACTTCTCGAGAAGTCCACCTGTGTTCTCCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008918
PPY MISSION shRNA Lentiviral Transduction Particles
pancreatic polypeptide
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008918.1-196s1c1
Sequence:CCGGGCAGATACATCAACACACTGACTCGAGTCAGTGTGTTGATGTATCTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008918.1-162s1c1
Sequence:CCGGCCTGAGCAGATGGCACAATATCTCGAGATATTGTGCCATCTGCTCAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008918.1-65s1c1
Sequence:CCGGGTTTCTCGTATCCACTTGGGTCTCGAGACCCAAGTGGATACGAGAAACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008918.1-134s1c1
Sequence:CCGGGCCAATGTACCCAGGCGACTACTCGAGTAGTCGCCTGGGTACATTGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008918.1-246s1c1
Sequence:CCGGGAGGAGAACACAGGTGGACTTCTCGAGAAGTCCACCTGTGTTCTCCTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002722
PPY MISSION shRNA Bacterial Glycerol Stock
pancreatic polypeptide
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002722.3-91s21c1
Sequence:CCGGTGCGTGGCTCTGTTACTACAGCTCGAGCTGTAGTAACAGAGCCACGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002722.2-164s1c1
Sequence:CCGGGATACATCAACATGCTGACCACTCGAGTGGTCAGCATGTTGATGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002722.3-193s21c1
Sequence:CCGGGCAGCTGATCTCCGTAGATACCTCGAGGTATCTACGGAGATCAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002722.3-162s21c1
Sequence:CCGGCAATGCCACACCAGAGCAGATCTCGAGATCTGCTCTGGTGTGGCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002722.3-220s21c1
Sequence:CCGGATGCTGACCAGGCCTAGGTATCTCGAGATACCTAGGCCTGGTCAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002722.2-160s1c1
Sequence:CCGGCGTAGATACATCAACATGCTGCTCGAGCAGCATGTTGATGTATCTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002722.3-247s21c1
Sequence:CCGGAGACACAAAGAGGACACGCTGCTCGAGCAGCGTGTCCTCTTTGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002722
PPY MISSION shRNA shRNA Plasmid DNA
pancreatic polypeptide
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002722.3-91s21c1
Sequence:CCGGTGCGTGGCTCTGTTACTACAGCTCGAGCTGTAGTAACAGAGCCACGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002722.2-164s1c1
Sequence:CCGGGATACATCAACATGCTGACCACTCGAGTGGTCAGCATGTTGATGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002722.3-193s21c1
Sequence:CCGGGCAGCTGATCTCCGTAGATACCTCGAGGTATCTACGGAGATCAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002722.3-162s21c1
Sequence:CCGGCAATGCCACACCAGAGCAGATCTCGAGATCTGCTCTGGTGTGGCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002722.3-220s21c1
Sequence:CCGGATGCTGACCAGGCCTAGGTATCTCGAGATACCTAGGCCTGGTCAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002722.2-160s1c1
Sequence:CCGGCGTAGATACATCAACATGCTGCTCGAGCAGCATGTTGATGTATCTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002722.3-247s21c1
Sequence:CCGGAGACACAAAGAGGACACGCTGCTCGAGCAGCGTGTCCTCTTTGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002722
PPY MISSION shRNA Lentiviral Transduction Particles
pancreatic polypeptide
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002722.3-91s21c1
Sequence:CCGGTGCGTGGCTCTGTTACTACAGCTCGAGCTGTAGTAACAGAGCCACGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002722.2-164s1c1
Sequence:CCGGGATACATCAACATGCTGACCACTCGAGTGGTCAGCATGTTGATGTATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002722.3-193s21c1
Sequence:CCGGGCAGCTGATCTCCGTAGATACCTCGAGGTATCTACGGAGATCAGCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002722.3-162s21c1
Sequence:CCGGCAATGCCACACCAGAGCAGATCTCGAGATCTGCTCTGGTGTGGCATTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002722.3-220s21c1
Sequence:CCGGATGCTGACCAGGCCTAGGTATCTCGAGATACCTAGGCCTGGTCAGCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002722.2-160s1c1
Sequence:CCGGCGTAGATACATCAACATGCTGCTCGAGCAGCATGTTGATGTATCTACGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002722.3-247s21c1
Sequence:CCGGAGACACAAAGAGGACACGCTGCTCGAGCAGCGTGTCCTCTTTGTGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)