EMAIL THIS PAGE TO A FRIEND

PQBP1

polyglutamine binding protein 1

122 Gene Product Result for
Synonyms: MRX55 MRXS3 MRXS8 NPW38 RENS1 SHS
Gene ID:
Human(10084) Summary: This gene encodes a nuclear polyglutamine-binding protein that is involved with transcription activation. The encoded protein contains a WW domain. Mutations in this gene have been found in patients with Renpenning syndrome 1 and other syndromes with X-linked mental retardation. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene.[provided by RefSeq, Nov 2009]
Mouse(54633) polyglutamine binding protein 1
Rat(302557) polyglutamine binding protein 1
fruit fly(43004) Poly-glutamine tract binding protein 1
dog(480909) polyglutamine binding protein 1
Zebrafish(796523) polyglutamine binding protein 1
domestic cat(101097213) polyglutamine binding protein 1
cow(534894) polyglutamine binding protein 1
sheep(101107670) polyglutamine binding protein 1
naked mole-rat(101709749) polyglutamine binding protein 1
domestic guinea pig(100732065) polyglutamine binding protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019478 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019478 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019478 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005710 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005710 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005710 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001032381 Rosetta Predictions human pricing
NM_001032382 Rosetta Predictions human pricing
NM_001032383 Rosetta Predictions human pricing
NM_001032384 Rosetta Predictions human pricing
NM_001032385 Rosetta Predictions human pricing
NM_005710 Rosetta Predictions human pricing
NM_001013957 Rosetta Predictions rat pricing
NM_019478 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032381 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227729 predicted 727
2 SASI_Hs02_00307925 predicted 674
3 SASI_Hs01_00227730 predicted 543
4 SASI_Hs01_00227731 predicted 308
5 SASI_Hs01_00227732 predicted 301
6 SASI_Hs01_00227733 predicted 357
7 SASI_Hs01_00227734 predicted 552
8 SASI_Hs01_00227735 predicted 550
9 SASI_Hs01_00227736 predicted 697
10 SASI_Hs01_00227737 predicted 521
11 SASI_Hs01_00227738 predicted 367
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032382 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069472 predicted 793
2 SASI_Hs02_00307926 predicted 734
3 SASI_Hs01_00069473 predicted 611
4 SASI_Hs01_00069474 predicted 374
5 SASI_Hs01_00069475 predicted 369
6 SASI_Hs01_00069476 predicted 425
7 SASI_Hs01_00069477 predicted 617
8 SASI_Hs01_00069478 predicted 617
9 SASI_Hs01_00069479 predicted 768
10 SASI_Hs01_00069480 predicted 593
11 SASI_Hs01_00069481 predicted 444
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032383 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221662 predicted 804
2 SASI_Hs02_00307927 predicted 749
3 SASI_Hs01_00221663 predicted 629
4 SASI_Hs01_00221664 predicted 382
5 SASI_Hs01_00221665 predicted 378
6 SASI_Hs01_00221666 predicted 437
7 SASI_Hs01_00221667 predicted 633
8 SASI_Hs01_00221668 predicted 629
9 SASI_Hs01_00221669 predicted 782
10 SASI_Hs01_00221670 predicted 603
11 SASI_Hs01_00221671 predicted 455
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032384 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077092 predicted 715
2 SASI_Hs02_00307928 predicted 659
3 SASI_Hs01_00077093 predicted 538
4 SASI_Hs01_00077094 predicted 287
5 SASI_Hs01_00077095 predicted 292
6 SASI_Hs01_00077096 predicted 351
7 SASI_Hs01_00077097 predicted 543
8 SASI_Hs01_00077098 predicted 534
9 SASI_Hs01_00077099 predicted 685
10 SASI_Hs01_00077100 predicted 512
11 SASI_Hs01_00077101 predicted 356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032385 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145433 predicted 277
2 SASI_Hs01_00145434 predicted 366
3 SASI_Hs01_00145435 predicted 641
4 SASI_Hs01_00145436 predicted 263
5 SASI_Hs01_00145437 predicted 622
6 SASI_Hs01_00145438 predicted 612
7 SASI_Hs01_00145439 predicted 379
8 SASI_Hs01_00145440 predicted 395
9 SASI_Hs01_00145441 predicted 434
10 SASI_Hs01_00145442 predicted 212
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005710 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179165 predicted 865
2 SASI_Hs02_00340131 predicted 802
3 SASI_Hs01_00179166 predicted 676
4 SASI_Hs01_00179167 predicted 436
5 SASI_Hs01_00179168 predicted 433
6 SASI_Hs01_00179169 predicted 490
7 SASI_Hs01_00179170 predicted 679
8 SASI_Hs01_00179171 predicted 679
9 SASI_Hs01_00179172 predicted 837
10 SASI_Hs01_00179173 predicted 655
11 SASI_Hs01_00179174 predicted 507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013957 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063745 predicted 612
2 SASI_Rn01_00063746 predicted 673
3 SASI_Rn01_00063747 predicted 622
4 SASI_Rn01_00063748 predicted 435
5 SASI_Rn01_00063751 predicted 794
6 SASI_Rn02_00201278 predicted 540
7 SASI_Rn01_00063752 predicted 482
8 SASI_Rn01_00063753 predicted 521
9 SASI_Rn01_00063754 predicted 332
10 SASI_Rn02_00201279 predicted 261
11 SASI_Rn01_00063749 predicted 308
12 SASI_Rn01_00063750 predicted 387
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019478 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157221 predicted 414
2 SASI_Mm01_00157222 predicted 468
3 SASI_Mm01_00157223 predicted 373
4 SASI_Mm01_00157224 predicted 258
5 SASI_Mm01_00157225 predicted 242
6 SASI_Mm01_00157226 predicted 414
7 SASI_Mm01_00157227 predicted 312
8 SASI_Mm01_00157228 predicted 335
9 SASI_Mm01_00157229 predicted 299
10 SASI_Mm01_00157230 predicted 327
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019478
VALIDATED
PQBP1 MISSION shRNA Bacterial Glycerol Stock
polyglutamine binding protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019478.3-345s21c1
Sequence:CCGGCCAAGAAAGTCAGGAACAATACTCGAGTATTGTTCCTGACTTTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019478.3-513s21c1
Sequence:CCGGACTACGACAAAGTGGATAGAGCTCGAGCTCTATCCACTTTGTCGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019478.3-228s21c1
Sequence:CCGGCGAGCTGGTACAAGGTGTTTGCTCGAGCAAACACCTTGTACCAGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337934    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019478.3-877s21c1
Sequence:CCGGCCCTTGTTCCCTGTAGCTTTGCTCGAGCAAAGCTACAGGGAACAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095924    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019478.2-905s1c1
Sequence:CCGGGCGTTTCTGTGTTTCTTCCTTCTCGAGAAGGAAGAAACACAGAAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019478.2-509s1c1
Sequence:CCGGCGCAACTACGACAAAGTGGATCTCGAGATCCACTTTGTCGTAGTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019478.2-320s1c1
Sequence:CCGGCCTAACTTTGTCGTTACCAAACTCGAGTTTGGTAACGACAAAGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019478.2-307s1c1
Sequence:CCGGCTCACCACATGATCCTAACTTCTCGAGAAGTTAGGATCATGTGGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019478.2-178s1c1
Sequence:CCGGCGATGATGATCCTGTTGACTACTCGAGTAGTCAACAGGATCATCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019478.3-309s21c1
Sequence:CCGGCACCACATGATCCTAACTTTGCTCGAGCAAAGTTAGGATCATGTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019478
VALIDATED
PQBP1 MISSION shRNA shRNA Plasmid DNA
polyglutamine binding protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019478.3-345s21c1
Sequence:CCGGCCAAGAAAGTCAGGAACAATACTCGAGTATTGTTCCTGACTTTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019478.3-513s21c1
Sequence:CCGGACTACGACAAAGTGGATAGAGCTCGAGCTCTATCCACTTTGTCGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019478.3-228s21c1
Sequence:CCGGCGAGCTGGTACAAGGTGTTTGCTCGAGCAAACACCTTGTACCAGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337934    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019478.3-877s21c1
Sequence:CCGGCCCTTGTTCCCTGTAGCTTTGCTCGAGCAAAGCTACAGGGAACAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095924    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019478.2-905s1c1
Sequence:CCGGGCGTTTCTGTGTTTCTTCCTTCTCGAGAAGGAAGAAACACAGAAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019478.2-509s1c1
Sequence:CCGGCGCAACTACGACAAAGTGGATCTCGAGATCCACTTTGTCGTAGTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019478.2-320s1c1
Sequence:CCGGCCTAACTTTGTCGTTACCAAACTCGAGTTTGGTAACGACAAAGTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019478.2-307s1c1
Sequence:CCGGCTCACCACATGATCCTAACTTCTCGAGAAGTTAGGATCATGTGGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019478.2-178s1c1
Sequence:CCGGCGATGATGATCCTGTTGACTACTCGAGTAGTCAACAGGATCATCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019478.3-309s21c1
Sequence:CCGGCACCACATGATCCTAACTTTGCTCGAGCAAAGTTAGGATCATGTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019478
VALIDATED
PQBP1 MISSION shRNA Lentiviral Transduction Particles
polyglutamine binding protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019478.3-345s21c1
Sequence:CCGGCCAAGAAAGTCAGGAACAATACTCGAGTATTGTTCCTGACTTTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019478.3-513s21c1
Sequence:CCGGACTACGACAAAGTGGATAGAGCTCGAGCTCTATCCACTTTGTCGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019478.3-228s21c1
Sequence:CCGGCGAGCTGGTACAAGGTGTTTGCTCGAGCAAACACCTTGTACCAGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337934    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019478.3-877s21c1
Sequence:CCGGCCCTTGTTCCCTGTAGCTTTGCTCGAGCAAAGCTACAGGGAACAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095924    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019478.2-905s1c1
Sequence:CCGGGCGTTTCTGTGTTTCTTCCTTCTCGAGAAGGAAGAAACACAGAAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019478.2-509s1c1
Sequence:CCGGCGCAACTACGACAAAGTGGATCTCGAGATCCACTTTGTCGTAGTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019478.2-320s1c1
Sequence:CCGGCCTAACTTTGTCGTTACCAAACTCGAGTTTGGTAACGACAAAGTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019478.2-307s1c1
Sequence:CCGGCTCACCACATGATCCTAACTTCTCGAGAAGTTAGGATCATGTGGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019478.2-178s1c1
Sequence:CCGGCGATGATGATCCTGTTGACTACTCGAGTAGTCAACAGGATCATCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019478.3-309s21c1
Sequence:CCGGCACCACATGATCCTAACTTTGCTCGAGCAAAGTTAGGATCATGTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005710
VALIDATED
PQBP1 MISSION shRNA Bacterial Glycerol Stock
polyglutamine binding protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005710.2-677s21c1
Sequence:CCGGTCGAGAGCGTGGCTATGACAACTCGAGTTGTCATAGCCACGCTCTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005710.2-537s21c1
Sequence:CCGGAGTAATGCAGATGCTGAAGAACTCGAGTTCTTCAGCATCTGCATTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005710.2-333s21c1
Sequence:CCGGGAGATCATTGCCGAGGACTATCTCGAGATAGTCCTCGGCAATGATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_005710.1-840s1c1
Sequence:CCGGAGCCGAAAGGATGAAGAGTTACTCGAGTAACTCTTCATCCTTTCGGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_005710.1-506s1c1
Sequence:CCGGCGTGGTTACCAAATCGGCCAACTCGAGTTGGCCGATTTGGTAACCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005710.1-336s1c1
Sequence:CCGGGAGATCATTGCCGAGGACTATCTCGAGATAGTCCTCGGCAATGATCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005710.1-443s1c1
Sequence:CCGGCCCTTACTACTGGAATGCAGACTCGAGTCTGCATTCCAGTAGTAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005710.1-306s1c1
Sequence:CCGGCTCAAACATCTGGAGCCTGAACTCGAGTTCAGGCTCCAGATGTTTGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005710.2-862s21c1
Sequence:CCGGCCATGGACCCTAGCTCATACTCTCGAGAGTATGAGCTAGGGTCCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005710.2-440s21c1
Sequence:CCGGCCCTTACTACTGGAATGCAGACTCGAGTCTGCATTCCAGTAGTAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005710
VALIDATED
PQBP1 MISSION shRNA shRNA Plasmid DNA
polyglutamine binding protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005710.2-677s21c1
Sequence:CCGGTCGAGAGCGTGGCTATGACAACTCGAGTTGTCATAGCCACGCTCTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005710.2-537s21c1
Sequence:CCGGAGTAATGCAGATGCTGAAGAACTCGAGTTCTTCAGCATCTGCATTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005710.2-333s21c1
Sequence:CCGGGAGATCATTGCCGAGGACTATCTCGAGATAGTCCTCGGCAATGATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_005710.1-840s1c1
Sequence:CCGGAGCCGAAAGGATGAAGAGTTACTCGAGTAACTCTTCATCCTTTCGGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_005710.1-506s1c1
Sequence:CCGGCGTGGTTACCAAATCGGCCAACTCGAGTTGGCCGATTTGGTAACCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005710.1-336s1c1
Sequence:CCGGGAGATCATTGCCGAGGACTATCTCGAGATAGTCCTCGGCAATGATCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005710.1-443s1c1
Sequence:CCGGCCCTTACTACTGGAATGCAGACTCGAGTCTGCATTCCAGTAGTAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005710.1-306s1c1
Sequence:CCGGCTCAAACATCTGGAGCCTGAACTCGAGTTCAGGCTCCAGATGTTTGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005710.2-862s21c1
Sequence:CCGGCCATGGACCCTAGCTCATACTCTCGAGAGTATGAGCTAGGGTCCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005710.2-440s21c1
Sequence:CCGGCCCTTACTACTGGAATGCAGACTCGAGTCTGCATTCCAGTAGTAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005710
VALIDATED
PQBP1 MISSION shRNA Lentiviral Transduction Particles
polyglutamine binding protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005710.2-677s21c1
Sequence:CCGGTCGAGAGCGTGGCTATGACAACTCGAGTTGTCATAGCCACGCTCTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005710.2-537s21c1
Sequence:CCGGAGTAATGCAGATGCTGAAGAACTCGAGTTCTTCAGCATCTGCATTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005710.2-333s21c1
Sequence:CCGGGAGATCATTGCCGAGGACTATCTCGAGATAGTCCTCGGCAATGATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_005710.1-840s1c1
Sequence:CCGGAGCCGAAAGGATGAAGAGTTACTCGAGTAACTCTTCATCCTTTCGGCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_005710.1-506s1c1
Sequence:CCGGCGTGGTTACCAAATCGGCCAACTCGAGTTGGCCGATTTGGTAACCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005710.1-336s1c1
Sequence:CCGGGAGATCATTGCCGAGGACTATCTCGAGATAGTCCTCGGCAATGATCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005710.1-443s1c1
Sequence:CCGGCCCTTACTACTGGAATGCAGACTCGAGTCTGCATTCCAGTAGTAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005710.1-306s1c1
Sequence:CCGGCTCAAACATCTGGAGCCTGAACTCGAGTTCAGGCTCCAGATGTTTGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005710.2-862s21c1
Sequence:CCGGCCATGGACCCTAGCTCATACTCTCGAGAGTATGAGCTAGGGTCCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005710.2-440s21c1
Sequence:CCGGCCCTTACTACTGGAATGCAGACTCGAGTCTGCATTCCAGTAGTAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)