EMAIL THIS PAGE TO A FRIEND

PQLC1

PQ loop repeat containing 1

40 Gene Product Result for
UniProtKB ID: Q8N2U9, B7Z7D9, Q9H6D0
Gene ID:
Mouse(66943) PQ loop repeat containing 1
Rat(361352) PQ loop repeat containing 1
chicken(428474) PQ loop repeat containing 1
domestic cat(101097023) PQ loop repeat containing 1
dog(476157) PQ loop repeat containing 1
domestic guinea pig(100729422) PQ loop repeat containing 1
naked mole-rat(101725747) PQ loop repeat containing 1
cow(533304) PQ loop repeat containing 1
sheep(100145870) PQ loop repeat containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA051666 Anti-PQLC1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025078 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025078 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025078 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025861 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025861 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025861 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025078 Rosetta Predictions human pricing
NM_001013189 Rosetta Predictions rat pricing
NM_025861 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025078 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095934 predicted 1239
2 SASI_Hs01_00095935 predicted 242
3 SASI_Hs02_00357759 predicted 274
4 SASI_Hs01_00095936 predicted 623
5 SASI_Hs01_00095937 predicted 599
6 SASI_Hs01_00095938 predicted 380
7 SASI_Hs01_00095939 predicted 633
8 SASI_Hs01_00095940 predicted 258
9 SASI_Hs01_00095941 predicted 930
10 SASI_Hs02_00357760 predicted 1269
11 SASI_Hs01_00095942 predicted 1259
12 SASI_Hs01_00095943 predicted 727
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013189 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080012 predicted 542
2 SASI_Rn01_00080013 predicted 1308
3 SASI_Rn01_00080014 predicted 285
4 SASI_Rn01_00080015 predicted 245
5 SASI_Rn01_00080016 predicted 419
6 SASI_Rn01_00080017 predicted 293
7 SASI_Rn01_00080018 predicted 1125
8 SASI_Rn01_00080019 predicted 279
9 SASI_Rn01_00080020 predicted 275
10 SASI_Rn01_00080021 predicted 1239
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025861 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140958 predicted 732
2 SASI_Mm02_00329170 predicted 1298
3 SASI_Mm01_00140960 predicted 1796
4 SASI_Mm01_00140961 predicted 1679
5 SASI_Mm01_00140962 predicted 1831
6 SASI_Mm01_00140963 predicted 855
7 SASI_Mm01_00140964 predicted 1782
8 SASI_Mm01_00140965 predicted 767
9 SASI_Mm02_00329171 predicted 1170
10 SASI_Mm01_00140966 predicted 1251
11 SASI_Mm01_00140959 predicted 1697
12 SASI_Mm01_00140967 predicted 1083
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025078
VALIDATED
PQLC1 MISSION shRNA Bacterial Glycerol Stock
PQ loop repeat containing 1
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025078.3-326s1c1
Sequence:CCGGCGGATACTCTTCTGGTTTGGACTCGAGTCCAAACCAGAAGAGTATCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025078.3-476s1c1
Sequence:CCGGGCAGATAGCAAGGATGAAGAACTCGAGTTCTTCATCCTTGCTATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025078.4-813s21c1
Sequence:CCGGACGCCTTCAAGACGGCCTACTCTCGAGAGTAGGCCGTCTTGAAGGCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025078.4-662s21c1
Sequence:CCGGTCCATTGACTCCGCCCTGTTTCTCGAGAAACAGGGCGGAGTCAATGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025078.4-522s21c1
Sequence:CCGGAGGATGAAGAAGTCAAGGTTGCTCGAGCAACCTTGACTTCTTCATCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025078.3-328s1c1
Sequence:CCGGGATACTCTTCTGGTTTGGAAGCTCGAGCTTCCAAACCAGAAGAGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025078.3-610s1c1
Sequence:CCGGCTACATCACCTACCTGTCCATCTCGAGATGGACAGGTAGGTGATGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156750    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025078.3-1947s1c1
Sequence:CCGGGCCTGAAGCAAATTCCTGAGTCTCGAGACTCAGGAATTTGCTTCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025078.3-742s1c1
Sequence:CCGGGAGCATCAAGATGGTGCTCATCTCGAGATGAGCACCATCTTGATGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025078.3-613s1c1
Sequence:CCGGCATCACCTACCTGTCCATTGACTCGAGTCAATGGACAGGTAGGTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025078.3-739s1c1
Sequence:CCGGCATGAGCATCAAGATGGTGCTCTCGAGAGCACCATCTTGATGCTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025078.4-279s21c1
Sequence:CCGGAGTATCGGGACATTCGCAGGACTCGAGTCCTGCGAATGTCCCGATACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025078.4-411s21c1
Sequence:CCGGAGAGCGCCATCATGATCCTGACTCGAGTCAGGATCATGATGGCGCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025078.4-287s21c1
Sequence:CCGGGACATTCGCAGGACGCAGAACCTCGAGGTTCTGCGTCCTGCGAATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025078.4-802s21c1
Sequence:CCGGGACCAGTGGTGACGCCTTCAACTCGAGTTGAAGGCGTCACCACTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025078.4-788s21c1
Sequence:CCGGATGGTGCTCATGTGGACCAGTCTCGAGACTGGTCCACATGAGCACCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025078
VALIDATED
PQLC1 MISSION shRNA shRNA Plasmid DNA
PQ loop repeat containing 1
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025078.3-326s1c1
Sequence:CCGGCGGATACTCTTCTGGTTTGGACTCGAGTCCAAACCAGAAGAGTATCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025078.3-476s1c1
Sequence:CCGGGCAGATAGCAAGGATGAAGAACTCGAGTTCTTCATCCTTGCTATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025078.4-813s21c1
Sequence:CCGGACGCCTTCAAGACGGCCTACTCTCGAGAGTAGGCCGTCTTGAAGGCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000444813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025078.4-662s21c1
Sequence:CCGGTCCATTGACTCCGCCCTGTTTCTCGAGAAACAGGGCGGAGTCAATGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025078.4-522s21c1
Sequence:CCGGAGGATGAAGAAGTCAAGGTTGCTCGAGCAACCTTGACTTCTTCATCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025078.3-328s1c1
Sequence:CCGGGATACTCTTCTGGTTTGGAAGCTCGAGCTTCCAAACCAGAAGAGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025078.3-610s1c1
Sequence:CCGGCTACATCACCTACCTGTCCATCTCGAGATGGACAGGTAGGTGATGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156750    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025078.3-1947s1c1
Sequence:CCGGGCCTGAAGCAAATTCCTGAGTCTCGAGACTCAGGAATTTGCTTCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025078.3-742s1c1
Sequence:CCGGGAGCATCAAGATGGTGCTCATCTCGAGATGAGCACCATCTTGATGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025078.3-613s1c1
Sequence:CCGGCATCACCTACCTGTCCATTGACTCGAGTCAATGGACAGGTAGGTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025078.3-739s1c1
Sequence:CCGGCATGAGCATCAAGATGGTGCTCTCGAGAGCACCATCTTGATGCTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025078.4-279s21c1
Sequence:CCGGAGTATCGGGACATTCGCAGGACTCGAGTCCTGCGAATGTCCCGATACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025078.4-411s21c1
Sequence:CCGGAGAGCGCCATCATGATCCTGACTCGAGTCAGGATCATGATGGCGCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025078.4-287s21c1
Sequence:CCGGGACATTCGCAGGACGCAGAACCTCGAGGTTCTGCGTCCTGCGAATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025078.4-802s21c1
Sequence:CCGGGACCAGTGGTGACGCCTTCAACTCGAGTTGAAGGCGTCACCACTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025078.4-788s21c1
Sequence:CCGGATGGTGCTCATGTGGACCAGTCTCGAGACTGGTCCACATGAGCACCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025078
VALIDATED
PQLC1 MISSION shRNA Lentiviral Transduction Particles
PQ loop repeat containing 1
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025078.3-326s1c1
Sequence:CCGGCGGATACTCTTCTGGTTTGGACTCGAGTCCAAACCAGAAGAGTATCCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025078.3-476s1c1
Sequence:CCGGGCAGATAGCAAGGATGAAGAACTCGAGTTCTTCATCCTTGCTATCTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025078.4-813s21c1
Sequence:CCGGACGCCTTCAAGACGGCCTACTCTCGAGAGTAGGCCGTCTTGAAGGCGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000444813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025078.4-662s21c1
Sequence:CCGGTCCATTGACTCCGCCCTGTTTCTCGAGAAACAGGGCGGAGTCAATGGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025078.4-522s21c1
Sequence:CCGGAGGATGAAGAAGTCAAGGTTGCTCGAGCAACCTTGACTTCTTCATCCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025078.3-328s1c1
Sequence:CCGGGATACTCTTCTGGTTTGGAAGCTCGAGCTTCCAAACCAGAAGAGTATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025078.3-610s1c1
Sequence:CCGGCTACATCACCTACCTGTCCATCTCGAGATGGACAGGTAGGTGATGTAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156750    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025078.3-1947s1c1
Sequence:CCGGGCCTGAAGCAAATTCCTGAGTCTCGAGACTCAGGAATTTGCTTCAGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025078.3-742s1c1
Sequence:CCGGGAGCATCAAGATGGTGCTCATCTCGAGATGAGCACCATCTTGATGCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025078.3-613s1c1
Sequence:CCGGCATCACCTACCTGTCCATTGACTCGAGTCAATGGACAGGTAGGTGATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025078.3-739s1c1
Sequence:CCGGCATGAGCATCAAGATGGTGCTCTCGAGAGCACCATCTTGATGCTCATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025078.4-279s21c1
Sequence:CCGGAGTATCGGGACATTCGCAGGACTCGAGTCCTGCGAATGTCCCGATACTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025078.4-411s21c1
Sequence:CCGGAGAGCGCCATCATGATCCTGACTCGAGTCAGGATCATGATGGCGCTCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025078.4-287s21c1
Sequence:CCGGGACATTCGCAGGACGCAGAACCTCGAGGTTCTGCGTCCTGCGAATGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025078.4-802s21c1
Sequence:CCGGGACCAGTGGTGACGCCTTCAACTCGAGTTGAAGGCGTCACCACTGGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025078.4-788s21c1
Sequence:CCGGATGGTGCTCATGTGGACCAGTCTCGAGACTGGTCCACATGAGCACCATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025861
PQLC1 MISSION shRNA Bacterial Glycerol Stock
PQ loop repeat containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025861.1-1959s1c1
Sequence:CCGGGCTCATCTTGAGATCATGTTACTCGAGTAACATGATCTCAAGATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182654    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025861.1-1869s1c1
Sequence:CCGGGCCCTTGTATGCCATAGCTATCTCGAGATAGCTATGGCATACAAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025861.1-848s1c1
Sequence:CCGGCAGAGCATAGTCATGATCCTTCTCGAGAAGGATCATGACTATGCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025861.1-853s1c1
Sequence:CCGGCATAGTCATGATCCTTACGATCTCGAGATCGTAAGGATCATGACTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025861.1-1255s1c1
Sequence:CCGGCTTCAAGACGGCCTACTTCTTCTCGAGAAGAAGTAGGCCGTCTTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025861
PQLC1 MISSION shRNA shRNA Plasmid DNA
PQ loop repeat containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025861.1-1959s1c1
Sequence:CCGGGCTCATCTTGAGATCATGTTACTCGAGTAACATGATCTCAAGATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182654    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025861.1-1869s1c1
Sequence:CCGGGCCCTTGTATGCCATAGCTATCTCGAGATAGCTATGGCATACAAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025861.1-848s1c1
Sequence:CCGGCAGAGCATAGTCATGATCCTTCTCGAGAAGGATCATGACTATGCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025861.1-853s1c1
Sequence:CCGGCATAGTCATGATCCTTACGATCTCGAGATCGTAAGGATCATGACTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025861.1-1255s1c1
Sequence:CCGGCTTCAAGACGGCCTACTTCTTCTCGAGAAGAAGTAGGCCGTCTTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025861
PQLC1 MISSION shRNA Lentiviral Transduction Particles
PQ loop repeat containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025861.1-1959s1c1
Sequence:CCGGGCTCATCTTGAGATCATGTTACTCGAGTAACATGATCTCAAGATGAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182654    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025861.1-1869s1c1
Sequence:CCGGGCCCTTGTATGCCATAGCTATCTCGAGATAGCTATGGCATACAAGGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025861.1-848s1c1
Sequence:CCGGCAGAGCATAGTCATGATCCTTCTCGAGAAGGATCATGACTATGCTCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025861.1-853s1c1
Sequence:CCGGCATAGTCATGATCCTTACGATCTCGAGATCGTAAGGATCATGACTATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025861.1-1255s1c1
Sequence:CCGGCTTCAAGACGGCCTACTTCTTCTCGAGAAGAAGTAGGCCGTCTTGAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)