EMAIL THIS PAGE TO A FRIEND

PQLC3

PQ loop repeat containing 3

43 Gene Product Result for
Synonyms: C2orf22
UniProtKB ID: Q8N755, B2R8K1
Gene ID:
Mouse(217430) PQ loop repeat containing
Rat(298906) PQ loop repeat containing 3
domestic guinea pig(100714629) PQ loop repeat containing 3
naked mole-rat(101724780) PQ loop repeat containing 3
cow(506958) PQ loop repeat containing 3
sheep(101119892) PQ loop repeat containing 3
Zebrafish(447876) PQ loop repeat containing 3
domestic cat(101094753) PQ loop repeat containing 3
dog(609944) PQ loop repeat containing 3
chicken(421941) PQ loop repeat containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA061607 Anti-PQLC3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152391 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152391 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152391 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172574 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172574 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172574 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152391 Rosetta Predictions human pricing
NM_001034952 Rosetta Predictions rat pricing
NM_172574 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152391 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199934 predicted 469
2 SASI_Hs01_00199935 predicted 413
3 SASI_Hs01_00199936 predicted 616
4 SASI_Hs01_00199937 predicted 417
5 SASI_Hs01_00199938 predicted 658
6 SASI_Hs02_00366062 predicted 606
7 SASI_Hs01_00199939 predicted 714
8 SASI_Hs02_00366063 predicted 792
9 SASI_Hs01_00199940 predicted 594
10 SASI_Hs01_00199941 predicted 620
11 SASI_Hs01_00199942 predicted 1030
12 SASI_Hs01_00199943 predicted 744
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034952 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085095 predicted 769
2 SASI_Rn01_00085097 predicted 225
3 SASI_Rn01_00085098 predicted 708
4 SASI_Rn02_00204144 predicted 779
5 SASI_Rn01_00085099 predicted 451
6 SASI_Rn01_00085102 predicted 673
7 SASI_Rn01_00085103 predicted 530
8 SASI_Rn02_00204145 predicted 668
9 SASI_Rn01_00085104 predicted 496
10 SASI_Rn02_00204146 predicted 876
11 SASI_Rn01_00085096 predicted 468
12 SASI_Rn01_00085100 predicted 662
13 SASI_Rn01_00085101 predicted 674
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172574 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168975 predicted 635
2 SASI_Mm01_00168984 predicted 600
3 SASI_Mm01_00168976 predicted 666
4 SASI_Mm01_00168977 predicted 794
5 SASI_Mm01_00168978 predicted 695
6 SASI_Mm02_00344238 predicted 710
7 SASI_Mm02_00344239 predicted 609
8 SASI_Mm01_00168980 predicted 432
9 SASI_Mm01_00168981 predicted 495
10 SASI_Mm02_00344240 predicted 481
11 SASI_Mm01_00168979 predicted 809
12 SASI_Mm01_00168982 predicted 754
13 SASI_Mm01_00168983 predicted 252
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152391
VALIDATED
PQLC3 MISSION shRNA Bacterial Glycerol Stock
PQ loop repeat containing 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_152391.3-456s21c1
Sequence:CCGGCCCTGCAGAAGTGGATCATAGCTCGAGCTATGATCCACTTCTGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152391.2-411s1c1
Sequence:CCGGCCACTCCTTACATCGCTGTATCTCGAGATACAGCGATGTAAGGAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_152391.3-735s21c1
Sequence:CCGGCTGAATGATGGATACATTATTCTCGAGAATAATGTATCCATCATTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_152391.3-412s21c1
Sequence:CCGGCACTCCTTACATCGCTGTATTCTCGAGAATACAGCGATGTAAGGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245605    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_152391.3-933s21c1
Sequence:CCGGTCCTCACTTCGTTAGGTTATGCTCGAGCATAACCTAACGAAGTGAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183349    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152391.2-1425s1c1
Sequence:CCGGGCTTTCTGATTCAAGTACAATCTCGAGATTGTACTTGAATCAGAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_152391.3-712s21c1
Sequence:CCGGCTACCGGAAGACCGCTATAAACTCGAGTTTATAGCGGTCTTCCGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152391
VALIDATED
PQLC3 MISSION shRNA shRNA Plasmid DNA
PQ loop repeat containing 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_152391.3-456s21c1
Sequence:CCGGCCCTGCAGAAGTGGATCATAGCTCGAGCTATGATCCACTTCTGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152391.2-411s1c1
Sequence:CCGGCCACTCCTTACATCGCTGTATCTCGAGATACAGCGATGTAAGGAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_152391.3-735s21c1
Sequence:CCGGCTGAATGATGGATACATTATTCTCGAGAATAATGTATCCATCATTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_152391.3-412s21c1
Sequence:CCGGCACTCCTTACATCGCTGTATTCTCGAGAATACAGCGATGTAAGGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245605    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_152391.3-933s21c1
Sequence:CCGGTCCTCACTTCGTTAGGTTATGCTCGAGCATAACCTAACGAAGTGAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183349    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152391.2-1425s1c1
Sequence:CCGGGCTTTCTGATTCAAGTACAATCTCGAGATTGTACTTGAATCAGAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_152391.3-712s21c1
Sequence:CCGGCTACCGGAAGACCGCTATAAACTCGAGTTTATAGCGGTCTTCCGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152391
VALIDATED
PQLC3 MISSION shRNA Lentiviral Transduction Particles
PQ loop repeat containing 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_152391.3-456s21c1
Sequence:CCGGCCCTGCAGAAGTGGATCATAGCTCGAGCTATGATCCACTTCTGCAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000180057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152391.2-411s1c1
Sequence:CCGGCCACTCCTTACATCGCTGTATCTCGAGATACAGCGATGTAAGGAGTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000245604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_152391.3-735s21c1
Sequence:CCGGCTGAATGATGGATACATTATTCTCGAGAATAATGTATCCATCATTCAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000245606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_152391.3-412s21c1
Sequence:CCGGCACTCCTTACATCGCTGTATTCTCGAGAATACAGCGATGTAAGGAGTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000245605    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_152391.3-933s21c1
Sequence:CCGGTCCTCACTTCGTTAGGTTATGCTCGAGCATAACCTAACGAAGTGAGGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000183349    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152391.2-1425s1c1
Sequence:CCGGGCTTTCTGATTCAAGTACAATCTCGAGATTGTACTTGAATCAGAAAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000245603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_152391.3-712s21c1
Sequence:CCGGCTACCGGAAGACCGCTATAAACTCGAGTTTATAGCGGTCTTCCGGTAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172574
VALIDATED
PQLC3 MISSION shRNA Bacterial Glycerol Stock
PQ loop repeat containing 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172574.1-381s21c1
Sequence:CCGGTTACCCTACATGGCCGTATTTCTCGAGAAATACGGCCATGTAGGGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172574.1-157s21c1
Sequence:CCGGCACTCAAGCTGCCGCAGATTTCTCGAGAAATCTGCGGCAGCTTGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183350    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172574.1-1337s1c1
Sequence:CCGGGCAGTTTAACTCTTCCATAAACTCGAGTTTATGGAAGAGTTAAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172574.1-428s1c1
Sequence:CCGGGCAGAAATGGATCATCGACTTCTCGAGAAGTCGATGATCCATTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172574.1-259s21c1
Sequence:CCGGTTCGTTATCAGCATTACTATGCTCGAGCATAGTAATGCTGATAACGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183351    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172574.1-828s1c1
Sequence:CCGGGCAGGTTTGTTAAACTTGAAACTCGAGTTTCAAGTTTAACAAACCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250456    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172574.1-1629s21c1
Sequence:CCGGCTAGCCAATTCTTAGGTATTTCTCGAGAAATACCTAAGAATTGGCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172574.1-472s21c1
Sequence:CCGGTTAGTGCAGCCAGTAAGTTTGCTCGAGCAAACTTACTGGCTGCACTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172574
VALIDATED
PQLC3 MISSION shRNA shRNA Plasmid DNA
PQ loop repeat containing 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172574.1-381s21c1
Sequence:CCGGTTACCCTACATGGCCGTATTTCTCGAGAAATACGGCCATGTAGGGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172574.1-157s21c1
Sequence:CCGGCACTCAAGCTGCCGCAGATTTCTCGAGAAATCTGCGGCAGCTTGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183350    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172574.1-1337s1c1
Sequence:CCGGGCAGTTTAACTCTTCCATAAACTCGAGTTTATGGAAGAGTTAAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172574.1-428s1c1
Sequence:CCGGGCAGAAATGGATCATCGACTTCTCGAGAAGTCGATGATCCATTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172574.1-259s21c1
Sequence:CCGGTTCGTTATCAGCATTACTATGCTCGAGCATAGTAATGCTGATAACGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183351    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172574.1-828s1c1
Sequence:CCGGGCAGGTTTGTTAAACTTGAAACTCGAGTTTCAAGTTTAACAAACCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250456    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172574.1-1629s21c1
Sequence:CCGGCTAGCCAATTCTTAGGTATTTCTCGAGAAATACCTAAGAATTGGCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172574.1-472s21c1
Sequence:CCGGTTAGTGCAGCCAGTAAGTTTGCTCGAGCAAACTTACTGGCTGCACTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172574
VALIDATED
PQLC3 MISSION shRNA Lentiviral Transduction Particles
PQ loop repeat containing 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172574.1-381s21c1
Sequence:CCGGTTACCCTACATGGCCGTATTTCTCGAGAAATACGGCCATGTAGGGTAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000250457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172574.1-157s21c1
Sequence:CCGGCACTCAAGCTGCCGCAGATTTCTCGAGAAATCTGCGGCAGCTTGAGTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000183350    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172574.1-1337s1c1
Sequence:CCGGGCAGTTTAACTCTTCCATAAACTCGAGTTTATGGAAGAGTTAAACTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000179281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172574.1-428s1c1
Sequence:CCGGGCAGAAATGGATCATCGACTTCTCGAGAAGTCGATGATCCATTTCTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000250455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172574.1-259s21c1
Sequence:CCGGTTCGTTATCAGCATTACTATGCTCGAGCATAGTAATGCTGATAACGAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000183351    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172574.1-828s1c1
Sequence:CCGGGCAGGTTTGTTAAACTTGAAACTCGAGTTTCAAGTTTAACAAACCTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000250456    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172574.1-1629s21c1
Sequence:CCGGCTAGCCAATTCTTAGGTATTTCTCGAGAAATACCTAAGAATTGGCTAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000250458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172574.1-472s21c1
Sequence:CCGGTTAGTGCAGCCAGTAAGTTTGCTCGAGCAAACTTACTGGCTGCACTAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???