EMAIL THIS PAGE TO A FRIEND

PRAC1

prostate cancer susceptibility candidate 1

19 Gene Product Result for
Synonyms: C17orf92 PRAC
Species: Human PRAC1(84366)
Gene ID:
Human(84366) Summary: This gene is reported to be specifically expressed in prostate, rectum and distal colon. Sequence analysis suggests that it may play a regulatory role in the nucleus. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032391 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032391 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032391 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU058641 MISSION® esiRNA esiRNA human C17orf92 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032391 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032391 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016926 predicted 155
2 SASI_Hs01_00016927 predicted 153
3 SASI_Hs01_00016928 predicted 129
4 SASI_Hs01_00016929 predicted 130
5 SASI_Hs01_00016930 predicted 148
6 SASI_Hs01_00016931 predicted 163
7 SASI_Hs02_00359788 predicted 204
8 SASI_Hs02_00359789 predicted 205
9 SASI_Hs01_00016932 predicted 164
10 SASI_Hs01_00016933 predicted 152
11 SASI_Hs01_00016934 predicted 143
12 SASI_Hs01_00016935 predicted 145
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032391
PRAC1 MISSION shRNA Bacterial Glycerol Stock
prostate cancer susceptibility candidate 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032391.2-250s21c1
Sequence:CCGGGCTCAGCCTGTAATTCTGGAACTCGAGTTCCAGAATTACAGGCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032391.2-165s1c1
Sequence:CCGGCATCTTACTACCTCCAAGAGTCTCGAGACTCTTGGAGGTAGTAAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032391.2-246s1c1
Sequence:CCGGGATGGCTCAGCCTGTAATTCTCTCGAGAGAATTACAGGCTGAGCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032391.2-136s21c1
Sequence:CCGGGCGCCCATTTCTCAGATCAAGCTCGAGCTTGATCTGAGAAATGGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032391.2-221s21c1
Sequence:CCGGACATCTACTGGGCGAGACCAGCTCGAGCTGGTCTCGCCCAGTAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032391.2-208s21c1
Sequence:CCGGCATCTACTTTGAAACATCTACCTCGAGGTAGATGTTTCAAAGTAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032391.2-170s21c1
Sequence:CCGGTACTACCTCCAAGAGTGCTTTCTCGAGAAAGCACTCTTGGAGGTAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032391.2-250s1c1
Sequence:CCGGGCTCAGCCTGTAATTCTGGAACTCGAGTTCCAGAATTACAGGCTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032391
PRAC1 MISSION shRNA shRNA Plasmid DNA
prostate cancer susceptibility candidate 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032391.2-250s21c1
Sequence:CCGGGCTCAGCCTGTAATTCTGGAACTCGAGTTCCAGAATTACAGGCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032391.2-165s1c1
Sequence:CCGGCATCTTACTACCTCCAAGAGTCTCGAGACTCTTGGAGGTAGTAAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032391.2-246s1c1
Sequence:CCGGGATGGCTCAGCCTGTAATTCTCTCGAGAGAATTACAGGCTGAGCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032391.2-136s21c1
Sequence:CCGGGCGCCCATTTCTCAGATCAAGCTCGAGCTTGATCTGAGAAATGGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032391.2-221s21c1
Sequence:CCGGACATCTACTGGGCGAGACCAGCTCGAGCTGGTCTCGCCCAGTAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032391.2-208s21c1
Sequence:CCGGCATCTACTTTGAAACATCTACCTCGAGGTAGATGTTTCAAAGTAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032391.2-170s21c1
Sequence:CCGGTACTACCTCCAAGAGTGCTTTCTCGAGAAAGCACTCTTGGAGGTAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032391.2-250s1c1
Sequence:CCGGGCTCAGCCTGTAATTCTGGAACTCGAGTTCCAGAATTACAGGCTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032391
PRAC1 MISSION shRNA Lentiviral Transduction Particles
prostate cancer susceptibility candidate 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032391.2-250s21c1
Sequence:CCGGGCTCAGCCTGTAATTCTGGAACTCGAGTTCCAGAATTACAGGCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032391.2-165s1c1
Sequence:CCGGCATCTTACTACCTCCAAGAGTCTCGAGACTCTTGGAGGTAGTAAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032391.2-246s1c1
Sequence:CCGGGATGGCTCAGCCTGTAATTCTCTCGAGAGAATTACAGGCTGAGCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032391.2-136s21c1
Sequence:CCGGGCGCCCATTTCTCAGATCAAGCTCGAGCTTGATCTGAGAAATGGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032391.2-221s21c1
Sequence:CCGGACATCTACTGGGCGAGACCAGCTCGAGCTGGTCTCGCCCAGTAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032391.2-208s21c1
Sequence:CCGGCATCTACTTTGAAACATCTACCTCGAGGTAGATGTTTCAAAGTAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032391.2-170s21c1
Sequence:CCGGTACTACCTCCAAGAGTGCTTTCTCGAGAAAGCACTCTTGGAGGTAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032391.2-250s1c1
Sequence:CCGGGCTCAGCCTGTAATTCTGGAACTCGAGTTCCAGAATTACAGGCTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)