EMAIL THIS PAGE TO A FRIEND

PRADC1

protease-associated domain containing 1

97 Gene Product Result for
Synonyms: C2orf7 PAP21
UniProtKB ID: Q9BSG0, Q2Z1P2
Gene ID:
Mouse(73327) protease-associated domain containing 1
Rat(686393) protease-associated domain containing 1
chicken(428807) protease-associated domain containing 1
dog(612337) protease-associated domain containing 1
domestic cat(101080524) protease-associated domain containing 1
cow(511492) protease-associated domain containing 1
sheep(101111951) protease-associated domain containing 1
naked mole-rat(101705532) protease-associated domain containing 1
domestic guinea pig(100717828) protease-associated domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032319 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032319 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032319 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028505 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028505 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028505 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032319 Rosetta Predictions human pricing
XM_001073919 Rosetta Predictions rat pricing
NM_028505 Rosetta Predictions mouse pricing
XM_898520 Rosetta Predictions mouse pricing
XM_898527 Rosetta Predictions mouse pricing
XM_978905 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032319 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173027 predicted 615
2 SASI_Hs01_00173029 predicted 393
3 SASI_Hs01_00173030 predicted 625
4 SASI_Hs01_00173031 predicted 288
5 SASI_Hs01_00173032 predicted 544
6 SASI_Hs01_00173033 predicted 400
7 SASI_Hs01_00173034 predicted 456
8 SASI_Hs01_00173035 predicted 588
9 SASI_Hs01_00173036 predicted 417
10 SASI_Hs02_00359672 predicted 637
11 SASI_Hs01_00173028 predicted 563
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073919 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00344397 predicted 415
2 SASI_Rn02_00344398 predicted 748
3 SASI_Rn02_00344399 predicted 703
4 SASI_Rn02_00344400 predicted 422
5 SASI_Rn02_00344401 predicted 237
6 SASI_Rn02_00344402 predicted 328
7 SASI_Rn02_00344403 predicted 689
8 SASI_Rn02_00344404 predicted 306
9 SASI_Rn02_00344405 predicted 710
10 SASI_Rn02_00344406 predicted 245
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028505 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333975 predicted 375
2 SASI_Mm02_00333976 predicted 378
3 SASI_Mm02_00333977 predicted 258
4 SASI_Mm02_00333978 predicted 294
5 SASI_Mm02_00333979 predicted 372
6 SASI_Mm02_00333980 predicted 324
7 SASI_Mm02_00333981 predicted 377
8 SASI_Mm02_00333982 predicted 345
9 SASI_Mm02_00333983 predicted 373
10 SASI_Mm02_00333984 predicted 311
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898520 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00202942 predicted 436
2 SASI_Mm01_00202943 predicted 724
3 SASI_Mm01_00202944 predicted 924
4 SASI_Mm01_00202945 predicted 821
5 SASI_Mm01_00202946 predicted 732
6 SASI_Mm01_00202947 predicted 942
7 SASI_Mm01_00202948 predicted 546
8 SASI_Mm01_00202949 predicted 531
9 SASI_Mm01_00202950 predicted 545
10 SASI_Mm01_00202951 predicted 576
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898527 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00235632 predicted 635
2 SASI_Mm01_00235633 predicted 830
3 SASI_Mm01_00235634 predicted 731
4 SASI_Mm01_00235635 predicted 637
5 SASI_Mm01_00235636 predicted 859
6 SASI_Mm01_00235637 predicted 454
7 SASI_Mm01_00235638 predicted 950
8 SASI_Mm01_00235639 predicted 432
9 SASI_Mm01_00235640 predicted 452
10 SASI_Mm01_00235641 predicted 486
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_978905 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00256613 predicted 607
2 SASI_Mm01_00256614 predicted 763
3 SASI_Mm01_00256615 predicted 355
4 SASI_Mm01_00256616 predicted 627
5 SASI_Mm01_00256617 predicted 451
6 SASI_Mm01_00256618 predicted 843
7 SASI_Mm01_00256619 predicted 726
8 SASI_Mm01_00256620 predicted 430
9 SASI_Mm01_00256621 predicted 444
10 SASI_Mm01_00256622 predicted 480
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032319
PRADC1 MISSION shRNA Bacterial Glycerol Stock
protease-associated domain containing 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032319.1-419s1c1
Sequence:CCGGCGCAGTTGACAATGACAGCTTCTCGAGAAGCTGTCATTGTCAACTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032319.1-705s1c1
Sequence:CCGGCTTGGAATTTGGAGATAGCATCTCGAGATGCTATCTCCAAATTCCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371546    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032319.1-870s21c1
Sequence:CCGGTCTGGCTAGAACCCGAAACAACTCGAGTTGTTTCGGGTTCTAGCCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032319.1-643s21c1
Sequence:CCGGTGTCCCACATTCCAGCCATAACTCGAGTTATGGCTGGAATGTGGGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032319.1-137s21c1
Sequence:CCGGCTTCCGTATCCATGATTATTTCTCGAGAAATAATCATGGATACGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032319.1-237s1c1
Sequence:CCGGCACACAAGGTATGAGCAGATTCTCGAGAATCTGCTCATACCTTGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032319.1-215s1c1
Sequence:CCGGCAAGGACTTTGGTGGTATCTTCTCGAGAAGATACCACCAAAGTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032319.1-560s1c1
Sequence:CCGGCATCATTTCCATCCCAGTCAACTCGAGTTGACTGGGATGGAAATGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032319
PRADC1 MISSION shRNA shRNA Plasmid DNA
protease-associated domain containing 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032319.1-419s1c1
Sequence:CCGGCGCAGTTGACAATGACAGCTTCTCGAGAAGCTGTCATTGTCAACTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032319.1-705s1c1
Sequence:CCGGCTTGGAATTTGGAGATAGCATCTCGAGATGCTATCTCCAAATTCCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371546    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032319.1-870s21c1
Sequence:CCGGTCTGGCTAGAACCCGAAACAACTCGAGTTGTTTCGGGTTCTAGCCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032319.1-643s21c1
Sequence:CCGGTGTCCCACATTCCAGCCATAACTCGAGTTATGGCTGGAATGTGGGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032319.1-137s21c1
Sequence:CCGGCTTCCGTATCCATGATTATTTCTCGAGAAATAATCATGGATACGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032319.1-237s1c1
Sequence:CCGGCACACAAGGTATGAGCAGATTCTCGAGAATCTGCTCATACCTTGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032319.1-215s1c1
Sequence:CCGGCAAGGACTTTGGTGGTATCTTCTCGAGAAGATACCACCAAAGTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032319.1-560s1c1
Sequence:CCGGCATCATTTCCATCCCAGTCAACTCGAGTTGACTGGGATGGAAATGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032319
PRADC1 MISSION shRNA Lentiviral Transduction Particles
protease-associated domain containing 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032319.1-419s1c1
Sequence:CCGGCGCAGTTGACAATGACAGCTTCTCGAGAAGCTGTCATTGTCAACTGCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000160478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032319.1-705s1c1
Sequence:CCGGCTTGGAATTTGGAGATAGCATCTCGAGATGCTATCTCCAAATTCCAAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000371546    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032319.1-870s21c1
Sequence:CCGGTCTGGCTAGAACCCGAAACAACTCGAGTTGTTTCGGGTTCTAGCCAGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000371545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032319.1-643s21c1
Sequence:CCGGTGTCCCACATTCCAGCCATAACTCGAGTTATGGCTGGAATGTGGGACATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000371484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032319.1-137s21c1
Sequence:CCGGCTTCCGTATCCATGATTATTTCTCGAGAAATAATCATGGATACGGAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000162077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032319.1-237s1c1
Sequence:CCGGCACACAAGGTATGAGCAGATTCTCGAGAATCTGCTCATACCTTGTGTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000162584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032319.1-215s1c1
Sequence:CCGGCAAGGACTTTGGTGGTATCTTCTCGAGAAGATACCACCAAAGTCCTTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000162651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032319.1-560s1c1
Sequence:CCGGCATCATTTCCATCCCAGTCAACTCGAGTTGACTGGGATGGAAATGATGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028505
VALIDATED
PRADC1 MISSION shRNA Bacterial Glycerol Stock
protease-associated domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028505.1-182s21c1
Sequence:CCGGGGGATATTCGATACATCTTCACTCGAGTGAAGATGTATCGAATATCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028505.1-140s21c1
Sequence:CCGGTACGCATCCATGACTACTTATCTCGAGATAAGTAGTCATGGATGCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028505.1-218s21c1
Sequence:CCGGAGGACTTTGGTGGGATATTTCCTCGAGGAAATATCCCACCAAAGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028505.1-297s21c1
Sequence:CCGGACTCAGCAACGGCTTCTTTATCTCGAGATAAAGAAGCCGTTGCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028505.1-395s21c1
Sequence:CCGGTCATCTCTATCCCAGTCAATGCTCGAGCATTGACTGGGATAGAGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028505
VALIDATED
PRADC1 MISSION shRNA shRNA Plasmid DNA
protease-associated domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028505.1-182s21c1
Sequence:CCGGGGGATATTCGATACATCTTCACTCGAGTGAAGATGTATCGAATATCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028505.1-140s21c1
Sequence:CCGGTACGCATCCATGACTACTTATCTCGAGATAAGTAGTCATGGATGCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028505.1-218s21c1
Sequence:CCGGAGGACTTTGGTGGGATATTTCCTCGAGGAAATATCCCACCAAAGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028505.1-297s21c1
Sequence:CCGGACTCAGCAACGGCTTCTTTATCTCGAGATAAAGAAGCCGTTGCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028505.1-395s21c1
Sequence:CCGGTCATCTCTATCCCAGTCAATGCTCGAGCATTGACTGGGATAGAGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028505
VALIDATED
PRADC1 MISSION shRNA Lentiviral Transduction Particles
protease-associated domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028505.1-182s21c1
Sequence:CCGGGGGATATTCGATACATCTTCACTCGAGTGAAGATGTATCGAATATCCCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000268268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028505.1-140s21c1
Sequence:CCGGTACGCATCCATGACTACTTATCTCGAGATAAGTAGTCATGGATGCGTATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000268267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028505.1-218s21c1
Sequence:CCGGAGGACTTTGGTGGGATATTTCCTCGAGGAAATATCCCACCAAAGTCCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000268216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028505.1-297s21c1
Sequence:CCGGACTCAGCAACGGCTTCTTTATCTCGAGATAAAGAAGCCGTTGCTGAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000268266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028505.1-395s21c1
Sequence:CCGGTCATCTCTATCCCAGTCAATGCTCGAGCATTGACTGGGATAGAGATGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???