EMAIL THIS PAGE TO A FRIEND

PRAF2

PRA1 domain family, member 2

48 Gene Product Result for
UniProtKB ID: O60831, B2RD20
Gene ID:
Mouse(54637) PRA1 domain family 2
Rat(367743) PRA1 domain family, member 2
Zebrafish(550393) PRA1 domain family, member 2
domestic cat(101100447) PRA1 domain family, member 2
dog(480912) PRA1 domain family, member 2
domestic guinea pig(100734310) PRA1 domain family, member 2
naked mole-rat(101718922) PRA1 domain family, member 2
cow(508703) PRA1 domain family, member 2
sheep(101106145) PRA1 domain family, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138602 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138602 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138602 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007213 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007213 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007213 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU130681 MISSION® esiRNA targeting human PRAF2 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007213 Rosetta Predictions human pricing
NM_001109013 Rosetta Predictions rat pricing
XM_346274 Rosetta Predictions rat pricing
NM_138602 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007213 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152573 predicted 979
2 SASI_Hs01_00152574 predicted 490
3 SASI_Hs01_00152575 predicted 501
4 SASI_Hs01_00152576 predicted 702
5 SASI_Hs01_00152577 predicted 1026
6 SASI_Hs01_00152578 predicted 456
7 SASI_Hs01_00152579 predicted 364
8 SASI_Hs01_00152580 predicted 670
9 SASI_Hs02_00343203 predicted 824
10 SASI_Hs02_00343204 predicted 908
11 SASI_Hs01_00152581 predicted 869
12 SASI_Hs01_00152582 predicted 434
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109013 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244314 predicted 1044
2 SASI_Rn02_00244315 predicted 688
3 SASI_Rn02_00244316 predicted 1104
4 SASI_Rn02_00244317 predicted 281
5 SASI_Rn02_00244318 predicted 1046
6 SASI_Rn02_00244319 predicted 901
7 SASI_Rn02_00244320 predicted 692
8 SASI_Rn02_00244321 predicted 917
9 SASI_Rn02_00244322 predicted 218
10 SASI_Rn02_00244323 predicted 1083
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_346274 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00129917 predicted 202
2 SASI_Rn01_00129918 predicted 206
3 SASI_Rn01_00129919 predicted 209
4 SASI_Rn01_00129920 predicted 139
5 SASI_Rn01_00129921 predicted 352
6 SASI_Rn01_00129922 predicted 366
7 SASI_Rn01_00129923 predicted 217
8 SASI_Rn01_00129924 predicted 126
9 SASI_Rn01_00129925 predicted 73
10 SASI_Rn01_00129926 predicted 141
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138602 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118242 predicted 717
2 SASI_Mm01_00118243 predicted 484
3 SASI_Mm01_00118244 predicted 967
4 SASI_Mm01_00118245 predicted 957
5 SASI_Mm01_00118246 predicted 983
6 SASI_Mm01_00118247 predicted 914
7 SASI_Mm01_00118248 predicted 564
8 SASI_Mm01_00118249 predicted 857
9 SASI_Mm01_00118250 predicted 895
10 SASI_Mm01_00118251 predicted 769
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138602
VALIDATED
PRAF2 MISSION shRNA Bacterial Glycerol Stock
PRA1 domain family, member 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138602.4-429s21c1
Sequence:CCGGCACTGCGTCTGAGAAACCTTACTCGAGTAAGGTTTCTCAGACGCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138602.4-161s21c1
Sequence:CCGGCTCTGCTTTGGCATCAGTCTTCTCGAGAAGACTGATGCCAAAGCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138602.4-332s21c1
Sequence:CCGGCTTGCCATTAGCCTCTTCATTCTCGAGAATGAAGAGGCTAATGGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138602.1-455s1c1
Sequence:CCGGCAAGATTGAGAACAAGATCGACTCGAGTCGATCTTGTTCTCAATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138602.1-162s1c1
Sequence:CCGGCTCTGCTTTGGCATCAGTCTTCTCGAGAAGACTGATGCCAAAGCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138602.1-430s1c1
Sequence:CCGGCACTGCGTCTGAGAAACCTTACTCGAGTAAGGTTTCTCAGACGCAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138602.1-333s1c1
Sequence:CCGGCTTGCCATTAGCCTCTTCATTCTCGAGAATGAAGAGGCTAATGGCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138602.4-454s21c1
Sequence:CCGGCAAGATTGAGAACAAGATCGACTCGAGTCGATCTTGTTCTCAATCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138602.1-432s1c1
Sequence:CCGGCTGCGTCTGAGAAACCTTAAACTCGAGTTTAAGGTTTCTCAGACGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138602
VALIDATED
PRAF2 MISSION shRNA shRNA Plasmid DNA
PRA1 domain family, member 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138602.4-429s21c1
Sequence:CCGGCACTGCGTCTGAGAAACCTTACTCGAGTAAGGTTTCTCAGACGCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138602.4-161s21c1
Sequence:CCGGCTCTGCTTTGGCATCAGTCTTCTCGAGAAGACTGATGCCAAAGCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138602.4-332s21c1
Sequence:CCGGCTTGCCATTAGCCTCTTCATTCTCGAGAATGAAGAGGCTAATGGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138602.1-455s1c1
Sequence:CCGGCAAGATTGAGAACAAGATCGACTCGAGTCGATCTTGTTCTCAATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138602.1-162s1c1
Sequence:CCGGCTCTGCTTTGGCATCAGTCTTCTCGAGAAGACTGATGCCAAAGCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138602.1-430s1c1
Sequence:CCGGCACTGCGTCTGAGAAACCTTACTCGAGTAAGGTTTCTCAGACGCAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138602.1-333s1c1
Sequence:CCGGCTTGCCATTAGCCTCTTCATTCTCGAGAATGAAGAGGCTAATGGCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138602.4-454s21c1
Sequence:CCGGCAAGATTGAGAACAAGATCGACTCGAGTCGATCTTGTTCTCAATCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138602.1-432s1c1
Sequence:CCGGCTGCGTCTGAGAAACCTTAAACTCGAGTTTAAGGTTTCTCAGACGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138602
VALIDATED
PRAF2 MISSION shRNA Lentiviral Transduction Particles
PRA1 domain family, member 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138602.4-429s21c1
Sequence:CCGGCACTGCGTCTGAGAAACCTTACTCGAGTAAGGTTTCTCAGACGCAGTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000320030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138602.4-161s21c1
Sequence:CCGGCTCTGCTTTGGCATCAGTCTTCTCGAGAAGACTGATGCCAAAGCAGAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000320032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138602.4-332s21c1
Sequence:CCGGCTTGCCATTAGCCTCTTCATTCTCGAGAATGAAGAGGCTAATGGCAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000174382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138602.1-455s1c1
Sequence:CCGGCAAGATTGAGAACAAGATCGACTCGAGTCGATCTTGTTCTCAATCTTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000173785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138602.1-162s1c1
Sequence:CCGGCTCTGCTTTGGCATCAGTCTTCTCGAGAAGACTGATGCCAAAGCAGAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000173824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138602.1-430s1c1
Sequence:CCGGCACTGCGTCTGAGAAACCTTACTCGAGTAAGGTTTCTCAGACGCAGTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000176420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138602.1-333s1c1
Sequence:CCGGCTTGCCATTAGCCTCTTCATTCTCGAGAATGAAGAGGCTAATGGCAAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000320033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138602.4-454s21c1
Sequence:CCGGCAAGATTGAGAACAAGATCGACTCGAGTCGATCTTGTTCTCAATCTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000175440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138602.1-432s1c1
Sequence:CCGGCTGCGTCTGAGAAACCTTAAACTCGAGTTTAAGGTTTCTCAGACGCAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007213
PRAF2 MISSION shRNA Bacterial Glycerol Stock
PRA1 domain family, member 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007213.1-472s1c1
Sequence:CCGGGATCGAGAGCATTGGTCTCAACTCGAGTTGAGACCAATGCTCTCGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159704    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007213.1-984s1c1
Sequence:CCGGGTCAAGACATTGCCAAATCTTCTCGAGAAGATTTGGCAATGTCTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007213.1-443s1c1
Sequence:CCGGCGCAACCTTAAGAACAAGATTCTCGAGAATCTTGTTCTTAAGGTTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007213.1-124s1c1
Sequence:CCGGCGTCATCAACAACCTCCTCTACTCGAGTAGAGGAGGTTGTTGATGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007213.1-741s21c1
Sequence:CCAGCATTACCTAGGGACAAGAGTCCTCGAGGACTCTTGTCCCTAGGTAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007213.1-196s21c1
Sequence:CCGGGTACGTGCGGCCACTTCATACCTCGAGGTATGAAGTGGCCGCACGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163869    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007213.1-980s1c1
Sequence:CCGGCCAGGTCAAGACATTGCCAAACTCGAGTTTGGCAATGTCTTGACCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007213.1-449s1c1
Sequence:CCGGCTTAAGAACAAGATTGAGAACCTCGAGGTTCTCAATCTTGTTCTTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007213.1-139s1c1
Sequence:CCGGCCTCTACTACCAAACCAACTACTCGAGTAGTTGGTTTGGTAGTAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007213
PRAF2 MISSION shRNA shRNA Plasmid DNA
PRA1 domain family, member 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007213.1-472s1c1
Sequence:CCGGGATCGAGAGCATTGGTCTCAACTCGAGTTGAGACCAATGCTCTCGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159704    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007213.1-984s1c1
Sequence:CCGGGTCAAGACATTGCCAAATCTTCTCGAGAAGATTTGGCAATGTCTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007213.1-443s1c1
Sequence:CCGGCGCAACCTTAAGAACAAGATTCTCGAGAATCTTGTTCTTAAGGTTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007213.1-124s1c1
Sequence:CCGGCGTCATCAACAACCTCCTCTACTCGAGTAGAGGAGGTTGTTGATGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007213.1-741s21c1
Sequence:CCAGCATTACCTAGGGACAAGAGTCCTCGAGGACTCTTGTCCCTAGGTAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007213.1-196s21c1
Sequence:CCGGGTACGTGCGGCCACTTCATACCTCGAGGTATGAAGTGGCCGCACGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163869    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007213.1-980s1c1
Sequence:CCGGCCAGGTCAAGACATTGCCAAACTCGAGTTTGGCAATGTCTTGACCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007213.1-449s1c1
Sequence:CCGGCTTAAGAACAAGATTGAGAACCTCGAGGTTCTCAATCTTGTTCTTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007213.1-139s1c1
Sequence:CCGGCCTCTACTACCAAACCAACTACTCGAGTAGTTGGTTTGGTAGTAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007213
PRAF2 MISSION shRNA Lentiviral Transduction Particles
PRA1 domain family, member 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007213.1-472s1c1
Sequence:CCGGGATCGAGAGCATTGGTCTCAACTCGAGTTGAGACCAATGCTCTCGATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000159704    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007213.1-984s1c1
Sequence:CCGGGTCAAGACATTGCCAAATCTTCTCGAGAAGATTTGGCAATGTCTTGACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000160065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007213.1-443s1c1
Sequence:CCGGCGCAACCTTAAGAACAAGATTCTCGAGAATCTTGTTCTTAAGGTTGCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000164569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007213.1-124s1c1
Sequence:CCGGCGTCATCAACAACCTCCTCTACTCGAGTAGAGGAGGTTGTTGATGACGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000433536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007213.1-741s21c1
Sequence:CCAGCATTACCTAGGGACAAGAGTCCTCGAGGACTCTTGTCCCTAGGTAATGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000418301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007213.1-196s21c1
Sequence:CCGGGTACGTGCGGCCACTTCATACCTCGAGGTATGAAGTGGCCGCACGTACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000163869    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007213.1-980s1c1
Sequence:CCGGCCAGGTCAAGACATTGCCAAACTCGAGTTTGGCAATGTCTTGACCTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000160013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007213.1-449s1c1
Sequence:CCGGCTTAAGAACAAGATTGAGAACCTCGAGGTTCTCAATCTTGTTCTTAAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000161778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007213.1-139s1c1
Sequence:CCGGCCTCTACTACCAAACCAACTACTCGAGTAGTTGGTTTGGTAGTAGAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???