EMAIL THIS PAGE TO A FRIEND

PRAM1

PML-RARA regulated adaptor molecule 1

52 Gene Product Result for
Synonyms: PML-RAR PRAM-1
UniProtKB ID: Q96QH2, Q8N6W7
Gene ID:
Human(84106) Summary: The protein encoded by this gene is similar to FYN binding protein (FYB/SLAP-130), an adaptor protein involved in T cell receptor mediated signaling. This gene is expressed and regulated during normal myelopoiesis. The expression of this gene is induced by retinoic acid and is inhibited by the expression of PML-RARalpha, a fusion protein of promyelocytic leukemia (PML) and the retinoic acid receptor-alpha (RARalpha). [provided by RefSeq, Jul 2008]
Mouse(378460) PML-RAR alpha-regulated adaptor molecule 1
Rat(362848) PML-RARA regulated adaptor molecule 1
domestic guinea pig(100713975) PML-RARA regulated adaptor molecule 1
naked mole-rat(101702398) PML-RARA regulated adaptor molecule 1
cow(504848) PML-RARA regulated adaptor molecule 1
sheep(101104576) PML-RARA regulated adaptor molecule 1
chicken(420067) PML-RARA regulated adaptor molecule 1
domestic cat(101093167) PML-RARA regulated adaptor molecule 1
Horse(100057936) PML-RARA regulated adaptor molecule 1
dog(611630) PML-RARA regulated adaptor molecule 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_128537 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_128537 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_128537 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032152 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032152 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032152 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032152 Rosetta Predictions human pricing
XM_001079157 Rosetta Predictions rat pricing
XM_343179 Rosetta Predictions rat pricing
NM_001002842 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032152 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114856 predicted 1863
2 SASI_Hs01_00114857 predicted 1739
3 SASI_Hs01_00114858 predicted 1430
4 SASI_Hs01_00114859 predicted 1764
5 SASI_Hs01_00114860 predicted 1585
6 SASI_Hs01_00114862 predicted 587
7 SASI_Hs01_00114863 predicted 1400
8 SASI_Hs01_00114864 predicted 1132
9 SASI_Hs02_00359387 predicted 369
10 SASI_Hs01_00114865 predicted 636
11 SASI_Hs01_00114861 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079157 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00363298 predicted 1874
2 SASI_Rn02_00363299 predicted 1652
3 SASI_Rn02_00363300 predicted 1992
4 SASI_Rn02_00363301 predicted 1986
5 SASI_Rn02_00363302 predicted 1607
6 SASI_Rn02_00363303 predicted 1401
7 SASI_Rn02_00363304 predicted 1151
8 SASI_Rn02_00363305 predicted 218
9 SASI_Rn02_00363306 predicted 1089
10 SASI_Rn02_00363307 predicted 1878
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343179 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395443 predicted 1870
2 SASI_Rn02_00395444 predicted 1892
3 SASI_Rn02_00395445 predicted 1990
4 SASI_Rn02_00395446 predicted 1991
5 SASI_Rn02_00395447 predicted 424
6 SASI_Rn02_00395448 predicted 1862
7 SASI_Rn02_00395449 predicted 1981
8 SASI_Rn02_00395450 predicted 221
9 SASI_Rn02_00395451 predicted 1886
10 SASI_Rn02_00395452 predicted 574
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002842 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048813 predicted 1187
2 SASI_Mm01_00048814 predicted 1782
3 SASI_Mm01_00048815 predicted 1560
4 SASI_Mm01_00048816 predicted 1141
5 SASI_Mm01_00048817 predicted 1308
6 SASI_Mm01_00048818 predicted 624
7 SASI_Mm01_00048819 predicted 1308
8 SASI_Mm01_00048820 predicted 1158
9 SASI_Mm01_00048821 predicted 818
10 SASI_Mm01_00048822 predicted 681
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_128537
PRAM1 MISSION shRNA Bacterial Glycerol Stock
PML-RARA regulated adaptor molecule 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128537.3-189s1c1
Sequence:CCGGGCCTGAGTTAAACAAAGTCCTCTCGAGAGGACTTTGTTTAACTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128537.3-880s1c1
Sequence:CCGGCCTAAGAACAATGAGAACTTTCTCGAGAAAGTTCTCATTGTTCTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128537.3-1920s1c1
Sequence:CCGGGCCCTTGGAAACAGAGGTATACTCGAGTATACCTCTGTTTCCAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128537.3-1743s1c1
Sequence:CCGGTGTGATTCACACGAAGATGATCTCGAGATCATCTTCGTGTGAATCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128537.3-870s1c1
Sequence:CCGGCAGTACCTTTCCTAAGAACAACTCGAGTTGTTCTTAGGAAAGGTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_128537
PRAM1 MISSION shRNA shRNA Plasmid DNA
PML-RARA regulated adaptor molecule 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128537.3-189s1c1
Sequence:CCGGGCCTGAGTTAAACAAAGTCCTCTCGAGAGGACTTTGTTTAACTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128537.3-880s1c1
Sequence:CCGGCCTAAGAACAATGAGAACTTTCTCGAGAAAGTTCTCATTGTTCTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128537.3-1920s1c1
Sequence:CCGGGCCCTTGGAAACAGAGGTATACTCGAGTATACCTCTGTTTCCAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128537.3-1743s1c1
Sequence:CCGGTGTGATTCACACGAAGATGATCTCGAGATCATCTTCGTGTGAATCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128537.3-870s1c1
Sequence:CCGGCAGTACCTTTCCTAAGAACAACTCGAGTTGTTCTTAGGAAAGGTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_128537
PRAM1 MISSION shRNA Lentiviral Transduction Particles
PML-RARA regulated adaptor molecule 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128537.3-189s1c1
Sequence:CCGGGCCTGAGTTAAACAAAGTCCTCTCGAGAGGACTTTGTTTAACTCAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000109942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128537.3-880s1c1
Sequence:CCGGCCTAAGAACAATGAGAACTTTCTCGAGAAAGTTCTCATTGTTCTTAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000109941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128537.3-1920s1c1
Sequence:CCGGGCCCTTGGAAACAGAGGTATACTCGAGTATACCTCTGTTTCCAAGGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000109944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128537.3-1743s1c1
Sequence:CCGGTGTGATTCACACGAAGATGATCTCGAGATCATCTTCGTGTGAATCACATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000109943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128537.3-870s1c1
Sequence:CCGGCAGTACCTTTCCTAAGAACAACTCGAGTTGTTCTTAGGAAAGGTACTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032152
PRAM1 MISSION shRNA Bacterial Glycerol Stock
PML-RARA regulated adaptor molecule 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000455017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032152.3-211s21c1
Sequence:CCGGTTGGTGCAGTGTCCTTGAAGCCTCGAGGCTTCAAGGACACTGCACCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032152.3-1871s21c1
Sequence:CCGGGATCGAGTTCACCAGCAATGACTCGAGTCATTGCTGGTGAACTCGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032152.3-58s21c1
Sequence:CCGGAGGACTTCCGGAGCATCAAAGCTCGAGCTTTGATGCTCCGGAAGTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032152.3-644s1c1
Sequence:CCGGGTTGAGTACCTTTCCCAAGAACTCGAGTTCTTGGGAAAGGTACTCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032152.3-1746s1c1
Sequence:CCGGCGGAAGAAGTTCAAGTTTGAACTCGAGTTCAAACTTGAACTTCTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032152.3-1974s1c1
Sequence:CCGGGATGATGTCGACTTCTGCGATCTCGAGATCGCAGAAGTCGACATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032152.3-134s1c1
Sequence:CCGGGCCTGAGTTTGGTAAACTGAACTCGAGTTCAGTTTACCAAACTCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032152.3-1524s1c1
Sequence:CCGGGATGAGATCTACGAGCTGTATCTCGAGATACAGCTCGTAGATCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032152
PRAM1 MISSION shRNA shRNA Plasmid DNA
PML-RARA regulated adaptor molecule 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000455017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032152.3-211s21c1
Sequence:CCGGTTGGTGCAGTGTCCTTGAAGCCTCGAGGCTTCAAGGACACTGCACCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032152.3-1871s21c1
Sequence:CCGGGATCGAGTTCACCAGCAATGACTCGAGTCATTGCTGGTGAACTCGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032152.3-58s21c1
Sequence:CCGGAGGACTTCCGGAGCATCAAAGCTCGAGCTTTGATGCTCCGGAAGTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032152.3-644s1c1
Sequence:CCGGGTTGAGTACCTTTCCCAAGAACTCGAGTTCTTGGGAAAGGTACTCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032152.3-1746s1c1
Sequence:CCGGCGGAAGAAGTTCAAGTTTGAACTCGAGTTCAAACTTGAACTTCTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032152.3-1974s1c1
Sequence:CCGGGATGATGTCGACTTCTGCGATCTCGAGATCGCAGAAGTCGACATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032152.3-134s1c1
Sequence:CCGGGCCTGAGTTTGGTAAACTGAACTCGAGTTCAGTTTACCAAACTCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032152.3-1524s1c1
Sequence:CCGGGATGAGATCTACGAGCTGTATCTCGAGATACAGCTCGTAGATCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032152
PRAM1 MISSION shRNA Lentiviral Transduction Particles
PML-RARA regulated adaptor molecule 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000455017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032152.3-211s21c1
Sequence:CCGGTTGGTGCAGTGTCCTTGAAGCCTCGAGGCTTCAAGGACACTGCACCAATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000426456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032152.3-1871s21c1
Sequence:CCGGGATCGAGTTCACCAGCAATGACTCGAGTCATTGCTGGTGAACTCGATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000446308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032152.3-58s21c1
Sequence:CCGGAGGACTTCCGGAGCATCAAAGCTCGAGCTTTGATGCTCCGGAAGTCCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000149680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032152.3-644s1c1
Sequence:CCGGGTTGAGTACCTTTCCCAAGAACTCGAGTTCTTGGGAAAGGTACTCAACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000183113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032152.3-1746s1c1
Sequence:CCGGCGGAAGAAGTTCAAGTTTGAACTCGAGTTCAAACTTGAACTTCTTCCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000180924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032152.3-1974s1c1
Sequence:CCGGGATGATGTCGACTTCTGCGATCTCGAGATCGCAGAAGTCGACATCATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000149709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032152.3-134s1c1
Sequence:CCGGGCCTGAGTTTGGTAAACTGAACTCGAGTTCAGTTTACCAAACTCAGGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000149778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032152.3-1524s1c1
Sequence:CCGGGATGAGATCTACGAGCTGTATCTCGAGATACAGCTCGTAGATCTCATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???