EMAIL THIS PAGE TO A FRIEND

PRAMEF10

PRAME family member 10

75 Gene Product Result for
Synonyms: RP5-845O24.7
Species: Human PRAMEF10(343071)
UniProtKB ID: O60809, Q2M1V2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039361 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039361 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039361 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039361 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039361 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115475 predicted 1207
2 SASI_Hs01_00115476 predicted 1286
3 SASI_Hs01_00115477 predicted 608
4 SASI_Hs02_00308469 predicted 1206
5 SASI_Hs01_00115478 predicted 793
6 SASI_Hs01_00115480 predicted 1133
7 SASI_Hs01_00115481 predicted 765
8 SASI_Hs01_00115482 predicted 625
9 SASI_Hs01_00115483 predicted 1098
10 SASI_Hs01_00115484 predicted 760
11 SASI_Hs01_00115479 predicted 1241
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039361
PRAMEF10 MISSION shRNA Bacterial Glycerol Stock
PRAME family member 10
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039361.3-793s21c1
Sequence:CCGGCTTCGGTTATGAGCGTGAGTTCTCGAGAACTCACGCTCATAACCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039361.3-663s21c1
Sequence:CCGGATCTATTGGAAAGGATATACCCTCGAGGGTATATCCTTTCCAATAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039361.3-695s21c1
Sequence:CCGGCAGGAGTTGGAAGTCTGGAAACTCGAGTTTCCAGACTTCCAACTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039361.3-575s21c1
Sequence:CCGGTTTGGGTGGATCCACTACAGACTCGAGTCTGTAGTGGATCCACCCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039361.3-761s21c1
Sequence:CCGGCAGATGAGCAATCTTCGTGAACTCGAGTTCACGAAGATTGCTCATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039361
PRAMEF10 MISSION shRNA shRNA Plasmid DNA
PRAME family member 10
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039361.3-793s21c1
Sequence:CCGGCTTCGGTTATGAGCGTGAGTTCTCGAGAACTCACGCTCATAACCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039361.3-663s21c1
Sequence:CCGGATCTATTGGAAAGGATATACCCTCGAGGGTATATCCTTTCCAATAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039361.3-695s21c1
Sequence:CCGGCAGGAGTTGGAAGTCTGGAAACTCGAGTTTCCAGACTTCCAACTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039361.3-575s21c1
Sequence:CCGGTTTGGGTGGATCCACTACAGACTCGAGTCTGTAGTGGATCCACCCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039361.3-761s21c1
Sequence:CCGGCAGATGAGCAATCTTCGTGAACTCGAGTTCACGAAGATTGCTCATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039361
PRAMEF10 MISSION shRNA Lentiviral Transduction Particles
PRAME family member 10
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039361.3-793s21c1
Sequence:CCGGCTTCGGTTATGAGCGTGAGTTCTCGAGAACTCACGCTCATAACCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039361.3-663s21c1
Sequence:CCGGATCTATTGGAAAGGATATACCCTCGAGGGTATATCCTTTCCAATAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039361.3-695s21c1
Sequence:CCGGCAGGAGTTGGAAGTCTGGAAACTCGAGTTTCCAGACTTCCAACTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039361.3-575s21c1
Sequence:CCGGTTTGGGTGGATCCACTACAGACTCGAGTCTGTAGTGGATCCACCCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039361.3-761s21c1
Sequence:CCGGCAGATGAGCAATCTTCGTGAACTCGAGTTCACGAAGATTGCTCATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)