EMAIL THIS PAGE TO A FRIEND

PRAMEF11

PRAME family member 11

6 Gene Product Result for
Synonyms: RP5-845O24.2
Species: Human PRAMEF11(440560)
UniProtKB ID: O60813
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305840 ANTI-PRAMEF11 (CENTER) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001146344 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001146344 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001146344 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001714028 Rosetta Predictions human pricing
XM_001714837 Rosetta Predictions human pricing
XM_001715375 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714028 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00394460 predicted 1361
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714837 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00399726 predicted 1356
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715375 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00403261 predicted 1355
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001146344
PRAMEF11 MISSION shRNA Bacterial Glycerol Stock
PRAME family member 11
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146344.1-1128s21c1
Sequence:CCGGCCCTTGAGTACCTGGATTTAGCTCGAGCTAAATCCAGGTACTCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146344.1-1454s21c1
Sequence:CCGGGACCATGGCGACAGGTCATTTCTCGAGAAATGACCTGTCGCCATGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146344.1-959s21c1
Sequence:CCGGTCGTTAAAGGTCCTCACAATACTCGAGTATTGTGAGGACCTTTAACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337113    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146344.1-1524s21c1
Sequence:CCGGATGGGTATGTCAAACGCTTTCCTCGAGGAAAGCGTTTGACATACCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146344.1-1064s21c1
Sequence:CCGGGGCATCAGACTGACCAATTACCTCGAGGTAATTGGTCAGTCTGATGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001146344
PRAMEF11 MISSION shRNA shRNA Plasmid DNA
PRAME family member 11
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146344.1-1128s21c1
Sequence:CCGGCCCTTGAGTACCTGGATTTAGCTCGAGCTAAATCCAGGTACTCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146344.1-1454s21c1
Sequence:CCGGGACCATGGCGACAGGTCATTTCTCGAGAAATGACCTGTCGCCATGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146344.1-959s21c1
Sequence:CCGGTCGTTAAAGGTCCTCACAATACTCGAGTATTGTGAGGACCTTTAACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337113    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146344.1-1524s21c1
Sequence:CCGGATGGGTATGTCAAACGCTTTCCTCGAGGAAAGCGTTTGACATACCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146344.1-1064s21c1
Sequence:CCGGGGCATCAGACTGACCAATTACCTCGAGGTAATTGGTCAGTCTGATGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001146344
PRAMEF11 MISSION shRNA Lentiviral Transduction Particles
PRAME family member 11
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146344.1-1128s21c1
Sequence:CCGGCCCTTGAGTACCTGGATTTAGCTCGAGCTAAATCCAGGTACTCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146344.1-1454s21c1
Sequence:CCGGGACCATGGCGACAGGTCATTTCTCGAGAAATGACCTGTCGCCATGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146344.1-959s21c1
Sequence:CCGGTCGTTAAAGGTCCTCACAATACTCGAGTATTGTGAGGACCTTTAACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337113    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146344.1-1524s21c1
Sequence:CCGGATGGGTATGTCAAACGCTTTCCTCGAGGAAAGCGTTTGACATACCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146344.1-1064s21c1
Sequence:CCGGGGCATCAGACTGACCAATTACCTCGAGGTAATTGGTCAGTCTGATGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)