EMAIL THIS PAGE TO A FRIEND

PRAMEF12

PRAME family member 12

59 Gene Product Result for
UniProtKB ID: O95522
Gene ID:
Mouse(77632) PRAME family member 12
Rat(691157) PRAME family member 12
naked mole-rat(101703213) PRAME family member 12
cow(100299866) PRAME family member 12
cow(529969) PRAME family member 12
sheep(101115813) PRAME family member 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029948 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029948 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029948 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080830 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080830 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080830 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080830 Rosetta Predictions human pricing
XM_372760 Rosetta Predictions human pricing
XM_001077034 Rosetta Predictions rat pricing
NM_029948 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080830 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316053 predicted 782
2 SASI_Hs02_00316054 predicted 1456
3 SASI_Hs02_00316055 predicted 1549
4 SASI_Hs02_00316056 predicted 361
5 SASI_Hs02_00316057 predicted 1497
6 SASI_Hs02_00316058 predicted 1268
7 SASI_Hs02_00316059 predicted 581
8 SASI_Hs02_00316060 predicted 1563
9 SASI_Hs02_00316061 predicted 818
10 SASI_Hs02_00316062 predicted 730
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_372760 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00278132 predicted 577
2 SASI_Hs01_00278133 predicted 1587
3 SASI_Hs01_00278134 predicted 1676
4 SASI_Hs01_00278135 predicted 490
5 SASI_Hs01_00278136 predicted 1623
6 SASI_Hs01_00278137 predicted 282
7 SASI_Hs01_00278138 predicted 1396
8 SASI_Hs01_00278139 predicted 710
9 SASI_Hs01_00278140 predicted 941
10 SASI_Hs01_00278141 predicted 863
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077034 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00355509 predicted 488
2 SASI_Rn02_00355510 predicted 359
3 SASI_Rn02_00355511 predicted 331
4 SASI_Rn02_00355512 predicted 948
5 SASI_Rn02_00355513 predicted 810
6 SASI_Rn02_00355514 predicted 960
7 SASI_Rn02_00355515 predicted 402
8 SASI_Rn02_00355516 predicted 758
9 SASI_Rn02_00355517 predicted 725
10 SASI_Rn02_00355518 predicted 532
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029948 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099784 predicted 574
2 SASI_Mm01_00099785 predicted 1131
3 SASI_Mm01_00099786 predicted 727
4 SASI_Mm01_00099787 predicted 361
5 SASI_Mm01_00099788 predicted 814
6 SASI_Mm01_00099789 predicted 844
7 SASI_Mm02_00336249 predicted 275
8 SASI_Mm01_00099790 predicted 622
9 SASI_Mm01_00099791 predicted 449
10 SASI_Mm01_00099792 predicted 1281
11 SASI_Mm01_00099793 predicted 765
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029948
PRAMEF12 MISSION shRNA Bacterial Glycerol Stock
PRAME family member 12
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029948.2-267s21c1
Sequence:CCGGCATCACTCACAAACGACTTAACTCGAGTTAAGTCGTTTGTGAGTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029948.2-1136s21c1
Sequence:CCGGGTGTCATTCTGACCGACATAACTCGAGTTATGTCGGTCAGAATGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184662    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029948.1-2022s1c1
Sequence:CCGGGCCGTGTCAGTGTAGATTCTACTCGAGTAGAATCTACACTGACACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029948.2-1287s21c1
Sequence:CCGGTATCATGTTCAACTACTTAAGCTCGAGCTTAAGTAGTTGAACATGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029948.2-1351s21c1
Sequence:CCGGACCTCCGGGCTGAACTATTTACTCGAGTAAATAGTTCAGCCCGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029948.1-1421s1c1
Sequence:CCGGGCTTCCTACCATAAGAGGCTACTCGAGTAGCCTCTTATGGTAGGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179316    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029948.1-2180s1c1
Sequence:CCGGGCTGACACATAGTAAAGGGATCTCGAGATCCCTTTACTATGTGTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029948.2-1865s21c1
Sequence:CCGGCTTCGGGCTATAGGGTAAATGCTCGAGCATTTACCCTATAGCCCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029948
PRAMEF12 MISSION shRNA shRNA Plasmid DNA
PRAME family member 12
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029948.2-267s21c1
Sequence:CCGGCATCACTCACAAACGACTTAACTCGAGTTAAGTCGTTTGTGAGTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029948.2-1136s21c1
Sequence:CCGGGTGTCATTCTGACCGACATAACTCGAGTTATGTCGGTCAGAATGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184662    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029948.1-2022s1c1
Sequence:CCGGGCCGTGTCAGTGTAGATTCTACTCGAGTAGAATCTACACTGACACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029948.2-1287s21c1
Sequence:CCGGTATCATGTTCAACTACTTAAGCTCGAGCTTAAGTAGTTGAACATGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029948.2-1351s21c1
Sequence:CCGGACCTCCGGGCTGAACTATTTACTCGAGTAAATAGTTCAGCCCGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029948.1-1421s1c1
Sequence:CCGGGCTTCCTACCATAAGAGGCTACTCGAGTAGCCTCTTATGGTAGGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179316    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029948.1-2180s1c1
Sequence:CCGGGCTGACACATAGTAAAGGGATCTCGAGATCCCTTTACTATGTGTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029948.2-1865s21c1
Sequence:CCGGCTTCGGGCTATAGGGTAAATGCTCGAGCATTTACCCTATAGCCCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029948
PRAMEF12 MISSION shRNA Lentiviral Transduction Particles
PRAME family member 12
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029948.2-267s21c1
Sequence:CCGGCATCACTCACAAACGACTTAACTCGAGTTAAGTCGTTTGTGAGTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029948.2-1136s21c1
Sequence:CCGGGTGTCATTCTGACCGACATAACTCGAGTTATGTCGGTCAGAATGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184662    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029948.1-2022s1c1
Sequence:CCGGGCCGTGTCAGTGTAGATTCTACTCGAGTAGAATCTACACTGACACGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029948.2-1287s21c1
Sequence:CCGGTATCATGTTCAACTACTTAAGCTCGAGCTTAAGTAGTTGAACATGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029948.2-1351s21c1
Sequence:CCGGACCTCCGGGCTGAACTATTTACTCGAGTAAATAGTTCAGCCCGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029948.1-1421s1c1
Sequence:CCGGGCTTCCTACCATAAGAGGCTACTCGAGTAGCCTCTTATGGTAGGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179316    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029948.1-2180s1c1
Sequence:CCGGGCTGACACATAGTAAAGGGATCTCGAGATCCCTTTACTATGTGTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029948.2-1865s21c1
Sequence:CCGGCTTCGGGCTATAGGGTAAATGCTCGAGCATTTACCCTATAGCCCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080830
PRAMEF12 MISSION shRNA Bacterial Glycerol Stock
PRAME family member 12
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080830.1-1456s21c1
Sequence:CCGGTGCTGTCAGGGTGGATTTATTCTCGAGAATAAATCCACCCTGACAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080830.1-823s21c1
Sequence:CCGGGACTACTTCCAGAAGCTTTACCTCGAGGTAAAGCTTCTGGAAGTAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080830.1-904s21c1
Sequence:CCGGCCCTTGGAGACAGTCGTAATGCTCGAGCATTACGACTGTCTCCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080830.1-668s21c1
Sequence:CCGGGGGAGCTGTCCATTCTTATAACTCGAGTTATAAGAATGGACAGCTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080830.1-1490s21c1
Sequence:CCGGTGGTCATTTGGCAACTGAATCCTCGAGGATTCAGTTGCCAAATGACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080830
PRAMEF12 MISSION shRNA shRNA Plasmid DNA
PRAME family member 12
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080830.1-1456s21c1
Sequence:CCGGTGCTGTCAGGGTGGATTTATTCTCGAGAATAAATCCACCCTGACAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080830.1-823s21c1
Sequence:CCGGGACTACTTCCAGAAGCTTTACCTCGAGGTAAAGCTTCTGGAAGTAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080830.1-904s21c1
Sequence:CCGGCCCTTGGAGACAGTCGTAATGCTCGAGCATTACGACTGTCTCCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080830.1-668s21c1
Sequence:CCGGGGGAGCTGTCCATTCTTATAACTCGAGTTATAAGAATGGACAGCTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080830.1-1490s21c1
Sequence:CCGGTGGTCATTTGGCAACTGAATCCTCGAGGATTCAGTTGCCAAATGACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080830
PRAMEF12 MISSION shRNA Lentiviral Transduction Particles
PRAME family member 12
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080830.1-1456s21c1
Sequence:CCGGTGCTGTCAGGGTGGATTTATTCTCGAGAATAAATCCACCCTGACAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080830.1-823s21c1
Sequence:CCGGGACTACTTCCAGAAGCTTTACCTCGAGGTAAAGCTTCTGGAAGTAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080830.1-904s21c1
Sequence:CCGGCCCTTGGAGACAGTCGTAATGCTCGAGCATTACGACTGTCTCCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080830.1-668s21c1
Sequence:CCGGGGGAGCTGTCCATTCTTATAACTCGAGTTATAAGAATGGACAGCTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080830.1-1490s21c1
Sequence:CCGGTGGTCATTTGGCAACTGAATCCTCGAGGATTCAGTTGCCAAATGACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)