EMAIL THIS PAGE TO A FRIEND

PRAMEF15

PRAME family member 15

24 Gene Product Result for
Species: Human PRAMEF15(653619), domestic guinea pig Pramef15(100719975)
Gene ID:
domestic guinea pig(100719975) PRAME family member 15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001098376 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001098376 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001098376 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098376 Rosetta Predictions human pricing
XM_001713659 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098376 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318778 predicted 1097
2 SASI_Hs02_00318779 predicted 1046
3 SASI_Hs02_00318780 predicted 1593
4 SASI_Hs02_00318781 predicted 1588
5 SASI_Hs02_00318782 predicted 1352
6 SASI_Hs02_00318783 predicted 625
7 SASI_Hs02_00318784 predicted 782
8 SASI_Hs02_00318785 predicted 612
9 SASI_Hs02_00318786 predicted 1102
10 SASI_Hs02_00318787 predicted 1248
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001713659 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00392543 predicted 1085
2 SASI_Hs02_00392544 predicted 1028
3 SASI_Hs02_00392545 predicted 1332
4 SASI_Hs02_00392546 predicted 600
5 SASI_Hs02_00392547 predicted 771
6 SASI_Hs02_00392548 predicted 599
7 SASI_Hs02_00392549 predicted 1088
8 SASI_Hs02_00392550 predicted 1240
9 SASI_Hs02_00392551 predicted 809
10 SASI_Hs02_00392552 predicted 531
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001098376
PRAMEF15 MISSION shRNA Bacterial Glycerol Stock
PRAME family member 15
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098376.2-663s21c1
Sequence:CCGGTGGGAATGCCCTTCCGCAATACTCGAGTATTGCGGAAGGGCATTCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098376.2-1090s21c1
Sequence:CCGGCATCAGACTGACCAATTATAGCTCGAGCTATAATTGGTCAGTCTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098376.2-969s21c1
Sequence:CCGGGCTGTCTGAAGACCTCGTTAACTCGAGTTAACGAGGTCTTCAGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098376.2-1570s21c1
Sequence:CCGGTCTGGACACTTGGAAACTAAACTCGAGTTTAGTTTCCAAGTGTCCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098376.2-1502s21c1
Sequence:CCGGGACCTGGAGGCAGATCAATACCTCGAGGTATTGATCTGCCTCCAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001098376
PRAMEF15 MISSION shRNA shRNA Plasmid DNA
PRAME family member 15
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098376.2-663s21c1
Sequence:CCGGTGGGAATGCCCTTCCGCAATACTCGAGTATTGCGGAAGGGCATTCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098376.2-1090s21c1
Sequence:CCGGCATCAGACTGACCAATTATAGCTCGAGCTATAATTGGTCAGTCTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098376.2-969s21c1
Sequence:CCGGGCTGTCTGAAGACCTCGTTAACTCGAGTTAACGAGGTCTTCAGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098376.2-1570s21c1
Sequence:CCGGTCTGGACACTTGGAAACTAAACTCGAGTTTAGTTTCCAAGTGTCCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098376.2-1502s21c1
Sequence:CCGGGACCTGGAGGCAGATCAATACCTCGAGGTATTGATCTGCCTCCAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001098376
PRAMEF15 MISSION shRNA Lentiviral Transduction Particles
PRAME family member 15
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098376.2-663s21c1
Sequence:CCGGTGGGAATGCCCTTCCGCAATACTCGAGTATTGCGGAAGGGCATTCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098376.2-1090s21c1
Sequence:CCGGCATCAGACTGACCAATTATAGCTCGAGCTATAATTGGTCAGTCTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098376.2-969s21c1
Sequence:CCGGGCTGTCTGAAGACCTCGTTAACTCGAGTTAACGAGGTCTTCAGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098376.2-1570s21c1
Sequence:CCGGTCTGGACACTTGGAAACTAAACTCGAGTTTAGTTTCCAAGTGTCCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098376.2-1502s21c1
Sequence:CCGGGACCTGGAGGCAGATCAATACCTCGAGGTATTGATCTGCCTCCAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)