EMAIL THIS PAGE TO A FRIEND

PRAMEF16

PRAME family member 16

18 Gene Product Result for
Species: Human PRAMEF16(654348)
UniProtKB ID: Q5VWM1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305841 ANTI-PRAMEF16(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001045480 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001045480 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001045480 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001045480 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001045480 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311452 predicted 1235
2 SASI_Hs02_00311453 predicted 753
3 SASI_Hs02_00311454 predicted 1270
4 SASI_Hs02_00311455 predicted 787
5 SASI_Hs02_00311456 predicted 1239
6 SASI_Hs02_00311457 predicted 756
7 SASI_Hs02_00311458 predicted 646
8 SASI_Hs02_00311459 predicted 635
9 SASI_Hs02_00311460 predicted 808
10 SASI_Hs02_00311461 predicted 770
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001045480
PRAMEF16 MISSION shRNA Bacterial Glycerol Stock
PRAME family member 16
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045480.1-1171s21c1
Sequence:CCGGACCTTCTACTTTCGCGGAAATCTCGAGATTTCCGCGAAAGTAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045480.1-830s21c1
Sequence:CCGGACTACCCTCAGATGCTTTATACTCGAGTATAAAGCATCTGAGGGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045480.1-1082s21c1
Sequence:CCGGTCGAGATCCTCACGTTAAAGGCTCGAGCCTTTAACGTGAGGATCTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045480.1-752s21c1
Sequence:CCGGTCGGTTATGACGATGAGTTATCTCGAGATAACTCATCGTCATAACCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045480.1-979s21c1
Sequence:CCGGCCAAGCCTCAGTCAGCTAAAGCTCGAGCTTTAGCTGACTGAGGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001045480
PRAMEF16 MISSION shRNA shRNA Plasmid DNA
PRAME family member 16
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045480.1-1171s21c1
Sequence:CCGGACCTTCTACTTTCGCGGAAATCTCGAGATTTCCGCGAAAGTAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045480.1-830s21c1
Sequence:CCGGACTACCCTCAGATGCTTTATACTCGAGTATAAAGCATCTGAGGGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045480.1-1082s21c1
Sequence:CCGGTCGAGATCCTCACGTTAAAGGCTCGAGCCTTTAACGTGAGGATCTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045480.1-752s21c1
Sequence:CCGGTCGGTTATGACGATGAGTTATCTCGAGATAACTCATCGTCATAACCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045480.1-979s21c1
Sequence:CCGGCCAAGCCTCAGTCAGCTAAAGCTCGAGCTTTAGCTGACTGAGGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001045480
PRAMEF16 MISSION shRNA Lentiviral Transduction Particles
PRAME family member 16
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045480.1-1171s21c1
Sequence:CCGGACCTTCTACTTTCGCGGAAATCTCGAGATTTCCGCGAAAGTAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045480.1-830s21c1
Sequence:CCGGACTACCCTCAGATGCTTTATACTCGAGTATAAAGCATCTGAGGGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045480.1-1082s21c1
Sequence:CCGGTCGAGATCCTCACGTTAAAGGCTCGAGCCTTTAACGTGAGGATCTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045480.1-752s21c1
Sequence:CCGGTCGGTTATGACGATGAGTTATCTCGAGATAACTCATCGTCATAACCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045480.1-979s21c1
Sequence:CCGGCCAAGCCTCAGTCAGCTAAAGCTCGAGCTTTAGCTGACTGAGGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)