EMAIL THIS PAGE TO A FRIEND

PRAMEF19

PRAME family member 19

7 Gene Product Result for
Species: Human PRAMEF19(645414)
UniProtKB ID: Q5SWL8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA057423 Anti-PRAMEF19 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001099790 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001099790 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001099790 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099790 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099790 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321508 predicted 912
2 SASI_Hs02_00321509 predicted 765
3 SASI_Hs02_00321510 predicted 939
4 SASI_Hs02_00321511 predicted 601
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099790
PRAMEF19 MISSION shRNA Bacterial Glycerol Stock
PRAME family member 19
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099790.1-591s21c1
Sequence:CCGGTGTACTAAGGTGGTAAATTATCTCGAGATAATTTACCACCTTAGTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099790.1-1714s21c1
Sequence:CCGGTGCCGGGTCTATAGGTGTATTCTCGAGAATACACCTATAGACCCGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099790.1-656s21c1
Sequence:CCGGCCCAGACAGTATCCAAGTATTCTCGAGAATACTTGGATACTGTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099790.1-927s21c1
Sequence:CCGGCCGTTGGAGACATTGGCATTACTCGAGTAATGCCAATGTCTCCAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099790.1-287s21c1
Sequence:CCGGTGTAGTGGATGGGATTGATTGCTCGAGCAATCAATCCCATCCACTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099790
PRAMEF19 MISSION shRNA shRNA Plasmid DNA
PRAME family member 19
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099790.1-591s21c1
Sequence:CCGGTGTACTAAGGTGGTAAATTATCTCGAGATAATTTACCACCTTAGTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099790.1-1714s21c1
Sequence:CCGGTGCCGGGTCTATAGGTGTATTCTCGAGAATACACCTATAGACCCGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099790.1-656s21c1
Sequence:CCGGCCCAGACAGTATCCAAGTATTCTCGAGAATACTTGGATACTGTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099790.1-927s21c1
Sequence:CCGGCCGTTGGAGACATTGGCATTACTCGAGTAATGCCAATGTCTCCAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099790.1-287s21c1
Sequence:CCGGTGTAGTGGATGGGATTGATTGCTCGAGCAATCAATCCCATCCACTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099790
PRAMEF19 MISSION shRNA Lentiviral Transduction Particles
PRAME family member 19
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099790.1-591s21c1
Sequence:CCGGTGTACTAAGGTGGTAAATTATCTCGAGATAATTTACCACCTTAGTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099790.1-1714s21c1
Sequence:CCGGTGCCGGGTCTATAGGTGTATTCTCGAGAATACACCTATAGACCCGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099790.1-656s21c1
Sequence:CCGGCCCAGACAGTATCCAAGTATTCTCGAGAATACTTGGATACTGTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099790.1-927s21c1
Sequence:CCGGCCGTTGGAGACATTGGCATTACTCGAGTAATGCCAATGTCTCCAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099790.1-287s21c1
Sequence:CCGGTGTAGTGGATGGGATTGATTGCTCGAGCAATCAATCCCATCCACTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)