EMAIL THIS PAGE TO A FRIEND

PRAMEF1

PRAME family member 1

4 Gene Product Result for
Species: Human PRAMEF1(65121)
UniProtKB ID: O95521, Q9UQP2
Gene ID:
Human(65121) Summary: This gene is a member of the PRAME (preferentially expressed antigen of melanoma) gene family which is expressed in many cancers but may function in reproductive tissues during development. [provided by RefSeq, Sep 2011]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305839 ANTI-PRAMEF1(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023013 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023013 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023013 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023013 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023013 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168594 predicted 840
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023013
PRAMEF1 MISSION shRNA Bacterial Glycerol Stock
PRAME family member 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023013.1-828s1c1
Sequence:CCGGGCCATCATTACACGTCAGATACTCGAGTATCTGACGTGTAATGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023013.1-1305s21c1
Sequence:CCGGCCAGTGGGCTGAGCAAGTTAACTCGAGTTAACTTGCTCAGCCCACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023013.1-902s21c1
Sequence:CCGGGAACACCTTCAGTTGCTTAAACTCGAGTTTAAGCAACTGAAGGTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023013.1-536s1c1
Sequence:CCGGCAGCCCTTAAAGGTGTTCATACTCGAGTATGAACACCTTTAAGGGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023013.1-759s1c1
Sequence:CCGGGTCTGATAAGAAAGCTTCGTTCTCGAGAACGAAGCTTTCTTATCAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023013.1-672s1c1
Sequence:CCGGCGCCGATTAAATATCTCAGAACTCGAGTTCTGAGATATTTAATCGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023013.1-1060s1c1
Sequence:CCGGCGGTTACCTAAAGCATCTGAACTCGAGTTCAGATGCTTTAGGTAACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023013
PRAMEF1 MISSION shRNA shRNA Plasmid DNA
PRAME family member 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023013.1-828s1c1
Sequence:CCGGGCCATCATTACACGTCAGATACTCGAGTATCTGACGTGTAATGATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023013.1-1305s21c1
Sequence:CCGGCCAGTGGGCTGAGCAAGTTAACTCGAGTTAACTTGCTCAGCCCACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023013.1-902s21c1
Sequence:CCGGGAACACCTTCAGTTGCTTAAACTCGAGTTTAAGCAACTGAAGGTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023013.1-536s1c1
Sequence:CCGGCAGCCCTTAAAGGTGTTCATACTCGAGTATGAACACCTTTAAGGGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023013.1-759s1c1
Sequence:CCGGGTCTGATAAGAAAGCTTCGTTCTCGAGAACGAAGCTTTCTTATCAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023013.1-672s1c1
Sequence:CCGGCGCCGATTAAATATCTCAGAACTCGAGTTCTGAGATATTTAATCGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023013.1-1060s1c1
Sequence:CCGGCGGTTACCTAAAGCATCTGAACTCGAGTTCAGATGCTTTAGGTAACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023013
PRAMEF1 MISSION shRNA Lentiviral Transduction Particles
PRAME family member 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023013.1-828s1c1
Sequence:CCGGGCCATCATTACACGTCAGATACTCGAGTATCTGACGTGTAATGATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023013.1-1305s21c1
Sequence:CCGGCCAGTGGGCTGAGCAAGTTAACTCGAGTTAACTTGCTCAGCCCACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023013.1-902s21c1
Sequence:CCGGGAACACCTTCAGTTGCTTAAACTCGAGTTTAAGCAACTGAAGGTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023013.1-536s1c1
Sequence:CCGGCAGCCCTTAAAGGTGTTCATACTCGAGTATGAACACCTTTAAGGGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023013.1-759s1c1
Sequence:CCGGGTCTGATAAGAAAGCTTCGTTCTCGAGAACGAAGCTTTCTTATCAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023013.1-672s1c1
Sequence:CCGGCGCCGATTAAATATCTCAGAACTCGAGTTCTGAGATATTTAATCGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023013.1-1060s1c1
Sequence:CCGGCGGTTACCTAAAGCATCTGAACTCGAGTTCAGATGCTTTAGGTAACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)