EMAIL THIS PAGE TO A FRIEND

PRAMEF20

PRAME family member 20

23 Gene Product Result for
UniProtKB ID: Q5VT98
Gene ID:
Rat(691150) PRAME family member 20
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305717 ANTI-PRAMEF20(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001099852 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001099852 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001099852 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099852 Rosetta Predictions human pricing
XM_001077012 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099852 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321526 predicted 729
2 SASI_Hs02_00321527 predicted 819
3 SASI_Hs02_00321528 predicted 1348
4 SASI_Hs02_00321529 predicted 1300
5 SASI_Hs02_00321530 predicted 1343
6 SASI_Hs02_00321531 predicted 659
7 SASI_Hs02_00321532 predicted 974
8 SASI_Hs02_00321533 predicted 812
9 SASI_Hs02_00321534 predicted 972
10 SASI_Hs02_00321535 predicted 974
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077012 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00355429 predicted 389
2 SASI_Rn02_00355430 predicted 680
3 SASI_Rn02_00355431 predicted 902
4 SASI_Rn02_00355432 predicted 963
5 SASI_Rn02_00355433 predicted 893
6 SASI_Rn02_00355434 predicted 580
7 SASI_Rn02_00355435 predicted 396
8 SASI_Rn02_00355436 predicted 1191
9 SASI_Rn02_00355437 predicted 903
10 SASI_Rn02_00355438 predicted 1202
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099852
PRAMEF20 MISSION shRNA Bacterial Glycerol Stock
PRAME family member 20
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099852.1-967s21c1
Sequence:CCGGTGTCTAAAGACCTCGTTAAACCTCGAGGTTTAACGAGGTCTTTAGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099852.1-1083s21c1
Sequence:CCGGTGGCACCAGACTGGCCAATTTCTCGAGAAATTGGCCAGTCTGGTGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099852.1-1048s21c1
Sequence:CCGGCCGAGCATTGGTCAACTAAAGCTCGAGCTTTAGTTGACCAATGCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099852.1-806s21c1
Sequence:CCGGAGCTCGTTCTCTCTGACATAGCTCGAGCTATGTCAGAGAGAACGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099852.1-663s21c1
Sequence:CCGGGGGAATGCTCTTCCACAATATCTCGAGATATTGTGGAAGAGCATTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099852
PRAMEF20 MISSION shRNA shRNA Plasmid DNA
PRAME family member 20
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099852.1-967s21c1
Sequence:CCGGTGTCTAAAGACCTCGTTAAACCTCGAGGTTTAACGAGGTCTTTAGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099852.1-1083s21c1
Sequence:CCGGTGGCACCAGACTGGCCAATTTCTCGAGAAATTGGCCAGTCTGGTGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099852.1-1048s21c1
Sequence:CCGGCCGAGCATTGGTCAACTAAAGCTCGAGCTTTAGTTGACCAATGCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099852.1-806s21c1
Sequence:CCGGAGCTCGTTCTCTCTGACATAGCTCGAGCTATGTCAGAGAGAACGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099852.1-663s21c1
Sequence:CCGGGGGAATGCTCTTCCACAATATCTCGAGATATTGTGGAAGAGCATTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099852
PRAMEF20 MISSION shRNA Lentiviral Transduction Particles
PRAME family member 20
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099852.1-967s21c1
Sequence:CCGGTGTCTAAAGACCTCGTTAAACCTCGAGGTTTAACGAGGTCTTTAGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099852.1-1083s21c1
Sequence:CCGGTGGCACCAGACTGGCCAATTTCTCGAGAAATTGGCCAGTCTGGTGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099852.1-1048s21c1
Sequence:CCGGCCGAGCATTGGTCAACTAAAGCTCGAGCTTTAGTTGACCAATGCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099852.1-806s21c1
Sequence:CCGGAGCTCGTTCTCTCTGACATAGCTCGAGCTATGTCAGAGAGAACGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099852.1-663s21c1
Sequence:CCGGGGGAATGCTCTTCCACAATATCTCGAGATATTGTGGAAGAGCATTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)