EMAIL THIS PAGE TO A FRIEND

PRAMEF21

PRAME family member 21

14 Gene Product Result for
Species: Human PRAMEF21(391001)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001100114 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001100114 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001100114 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100114 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100114 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321654 predicted 640
2 SASI_Hs02_00321655 predicted 725
3 SASI_Hs02_00321656 predicted 1260
4 SASI_Hs02_00321657 predicted 1207
5 SASI_Hs02_00321658 predicted 1260
6 SASI_Hs02_00321659 predicted 566
7 SASI_Hs02_00321660 predicted 888
8 SASI_Hs02_00321661 predicted 723
9 SASI_Hs02_00321662 predicted 882
10 SASI_Hs02_00321663 predicted 891
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001100114
PRAMEF21 MISSION shRNA Bacterial Glycerol Stock
PRAME family member 21
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100114.1-891s21c1
Sequence:CCGGCGTTAAACATCCTCGCAATAACTCGAGTTATTGCGAGGATGTTTAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100114.1-1151s21c1
Sequence:CCGGACCTTCAGCTTCCGTGGAAATCTCGAGATTTCCACGGAAGCTGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100114.1-478s21c1
Sequence:CCGGGAACAGGACTCTGGATGAATACTCGAGTATTCATCCAGAGTCCTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100114.1-372s21c1
Sequence:CCGGCCCGTAGGTGCTTACCAAATGCTCGAGCATTTGGTAAGCACCTACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100114.1-958s21c1
Sequence:CCGGCCCGAGCATTGGTCAACTAAACTCGAGTTTAGTTGACCAATGCTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001100114
PRAMEF21 MISSION shRNA shRNA Plasmid DNA
PRAME family member 21
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100114.1-891s21c1
Sequence:CCGGCGTTAAACATCCTCGCAATAACTCGAGTTATTGCGAGGATGTTTAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100114.1-1151s21c1
Sequence:CCGGACCTTCAGCTTCCGTGGAAATCTCGAGATTTCCACGGAAGCTGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100114.1-478s21c1
Sequence:CCGGGAACAGGACTCTGGATGAATACTCGAGTATTCATCCAGAGTCCTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100114.1-372s21c1
Sequence:CCGGCCCGTAGGTGCTTACCAAATGCTCGAGCATTTGGTAAGCACCTACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100114.1-958s21c1
Sequence:CCGGCCCGAGCATTGGTCAACTAAACTCGAGTTTAGTTGACCAATGCTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001100114
PRAMEF21 MISSION shRNA Lentiviral Transduction Particles
PRAME family member 21
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100114.1-891s21c1
Sequence:CCGGCGTTAAACATCCTCGCAATAACTCGAGTTATTGCGAGGATGTTTAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100114.1-1151s21c1
Sequence:CCGGACCTTCAGCTTCCGTGGAAATCTCGAGATTTCCACGGAAGCTGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100114.1-478s21c1
Sequence:CCGGGAACAGGACTCTGGATGAATACTCGAGTATTCATCCAGAGTCCTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100114.1-372s21c1
Sequence:CCGGCCCGTAGGTGCTTACCAAATGCTCGAGCATTTGGTAAGCACCTACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100114.1-958s21c1
Sequence:CCGGCCCGAGCATTGGTCAACTAAACTCGAGTTTAGTTGACCAATGCTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)