EMAIL THIS PAGE TO A FRIEND

PRAMEF3

PRAME family member 3

21 Gene Product Result for
Species: Human PRAMEF3(401940)
UniProtKB ID: Q5TYW8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301295 ANTI-PRAMEF3 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013692 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013692 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013692 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013692 Rosetta Predictions human pricing
XM_001713666 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013692 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206884 predicted 680
2 SASI_Hs02_00306461 predicted 674
3 SASI_Hs02_00306462 predicted 689
4 SASI_Hs02_00306463 predicted 680
5 SASI_Hs01_00206882 predicted 792
6 SASI_Hs01_00206883 predicted 721
7 SASI_Hs01_00206885 predicted 250
8 SASI_Hs01_00206886 predicted 486
9 SASI_Hs01_00206887 predicted 1243
10 SASI_Hs01_00206888 predicted 998
11 SASI_Hs01_00206889 predicted 456
12 SASI_Hs01_00206890 predicted 591
13 SASI_Hs01_00206891 predicted 918
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001713666 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00392593 predicted 908
2 SASI_Hs02_00392594 predicted 773
3 SASI_Hs02_00392595 predicted 939
4 SASI_Hs02_00392596 predicted 600
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013692
PRAMEF3 MISSION shRNA Bacterial Glycerol Stock
PRAME family member 3
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013692.1-775s1c1
Sequence:CCGGGACAGCCAAGAACAGTTAGTTCTCGAGAACTAACTGTTCTTGGCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013692.1-922s1c1
Sequence:CCGGGCATTAACTTATGGCTTCCTACTCGAGTAGGAAGCCATAAGTTAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013692.1-781s1c1
Sequence:CCGGCAAGAACAGTTAGTTGCTGAACTCGAGTTCAGCAACTAACTGTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013692.1-826s1c1
Sequence:CCGGGAGTACCTCCAGATGCTTTATCTCGAGATAAAGCATCTGGAGGTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013692.1-720s1c1
Sequence:CCGGGAGGAATCTTCGCAAACTCTTCTCGAGAAGAGTTTGCGAAGATTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013692.1-1925s1c1
Sequence:CCGGCGGAAGTAGAGGGAACCTAAACTCGAGTTTAGGTTCCCTCTACTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013692
PRAMEF3 MISSION shRNA shRNA Plasmid DNA
PRAME family member 3
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013692.1-775s1c1
Sequence:CCGGGACAGCCAAGAACAGTTAGTTCTCGAGAACTAACTGTTCTTGGCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013692.1-922s1c1
Sequence:CCGGGCATTAACTTATGGCTTCCTACTCGAGTAGGAAGCCATAAGTTAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013692.1-781s1c1
Sequence:CCGGCAAGAACAGTTAGTTGCTGAACTCGAGTTCAGCAACTAACTGTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013692.1-826s1c1
Sequence:CCGGGAGTACCTCCAGATGCTTTATCTCGAGATAAAGCATCTGGAGGTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013692.1-720s1c1
Sequence:CCGGGAGGAATCTTCGCAAACTCTTCTCGAGAAGAGTTTGCGAAGATTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013692.1-1925s1c1
Sequence:CCGGCGGAAGTAGAGGGAACCTAAACTCGAGTTTAGGTTCCCTCTACTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013692
PRAMEF3 MISSION shRNA Lentiviral Transduction Particles
PRAME family member 3
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013692.1-775s1c1
Sequence:CCGGGACAGCCAAGAACAGTTAGTTCTCGAGAACTAACTGTTCTTGGCTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013692.1-922s1c1
Sequence:CCGGGCATTAACTTATGGCTTCCTACTCGAGTAGGAAGCCATAAGTTAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013692.1-781s1c1
Sequence:CCGGCAAGAACAGTTAGTTGCTGAACTCGAGTTCAGCAACTAACTGTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013692.1-826s1c1
Sequence:CCGGGAGTACCTCCAGATGCTTTATCTCGAGATAAAGCATCTGGAGGTACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013692.1-720s1c1
Sequence:CCGGGAGGAATCTTCGCAAACTCTTCTCGAGAAGAGTTTGCGAAGATTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013692.1-1925s1c1
Sequence:CCGGCGGAAGTAGAGGGAACCTAAACTCGAGTTTAGGTTCCCTCTACTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)