EMAIL THIS PAGE TO A FRIEND

PRAMEF5

PRAME family member 5

42 Gene Product Result for
UniProtKB ID: Q5TYX0, A2BDD6, A4FU31
Gene ID:
Rat(298613) PRAME family member 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013407 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013407 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013407 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013407 Rosetta Predictions human pricing
XM_001073840 Rosetta Predictions rat pricing
XM_001076781 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013407 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054674 predicted 1036
2 SASI_Hs01_00054677 predicted 978
3 SASI_Hs01_00054678 predicted 822
4 SASI_Hs02_00306360 predicted 779
5 SASI_Hs01_00054672 predicted 1113
6 SASI_Hs01_00054673 predicted 1046
7 SASI_Hs02_00306361 predicted 1382
8 SASI_Hs01_00054676 predicted 1084
9 SASI_Hs02_00306362 predicted 1394
10 SASI_Hs01_00054680 predicted 1104
11 SASI_Hs01_00054675 predicted 919
12 SASI_Hs01_00054679 predicted 1154
13 SASI_Hs01_00054681 predicted 964
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073840 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00344147 predicted 495
2 SASI_Rn02_00344148 predicted 848
3 SASI_Rn02_00344149 predicted 893
4 SASI_Rn02_00344150 predicted 418
5 SASI_Rn02_00344151 predicted 570
6 SASI_Rn02_00344152 predicted 788
7 SASI_Rn02_00344153 predicted 309
8 SASI_Rn02_00344154 predicted 1239
9 SASI_Rn02_00344155 predicted 892
10 SASI_Rn02_00344156 predicted 1239
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076781 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00354554 predicted 495
2 SASI_Rn02_00354555 predicted 847
3 SASI_Rn02_00354556 predicted 893
4 SASI_Rn02_00354557 predicted 418
5 SASI_Rn02_00354558 predicted 571
6 SASI_Rn02_00354559 predicted 786
7 SASI_Rn02_00354560 predicted 310
8 SASI_Rn02_00354561 predicted 1237
9 SASI_Rn02_00354562 predicted 891
10 SASI_Rn02_00354563 predicted 1241
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013407
PRAMEF5 MISSION shRNA Bacterial Glycerol Stock
PRAME family member 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246088    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013407.1-1595s21c1
Sequence:CCGGAGGTCTTAGGTACATCCTATACTCGAGTATAGGATGTACCTAAGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013407.1-1526s21c1
Sequence:CCGGTGTTGAATGCCTGCCTATTTGCTCGAGCAAATAGGCAGGCATTCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013407.1-1293s21c1
Sequence:CCGGTGCTGAGCCACACAATCATACCTCGAGGTATGATTGTGTGGCTCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013407.1-1501s21c1
Sequence:CCGGTGACCTGGAGGCAGATCAATGCTCGAGCATTGATCTGCCTCCAGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013407.1-970s21c1
Sequence:CCGGCTGTCTGAAGACCTCGTTAAACTCGAGTTTAACGAGGTCTTCAGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013407
PRAMEF5 MISSION shRNA shRNA Plasmid DNA
PRAME family member 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246088    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013407.1-1595s21c1
Sequence:CCGGAGGTCTTAGGTACATCCTATACTCGAGTATAGGATGTACCTAAGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013407.1-1526s21c1
Sequence:CCGGTGTTGAATGCCTGCCTATTTGCTCGAGCAAATAGGCAGGCATTCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013407.1-1293s21c1
Sequence:CCGGTGCTGAGCCACACAATCATACCTCGAGGTATGATTGTGTGGCTCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013407.1-1501s21c1
Sequence:CCGGTGACCTGGAGGCAGATCAATGCTCGAGCATTGATCTGCCTCCAGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013407.1-970s21c1
Sequence:CCGGCTGTCTGAAGACCTCGTTAAACTCGAGTTTAACGAGGTCTTCAGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013407
PRAMEF5 MISSION shRNA Lentiviral Transduction Particles
PRAME family member 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246088    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013407.1-1595s21c1
Sequence:CCGGAGGTCTTAGGTACATCCTATACTCGAGTATAGGATGTACCTAAGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013407.1-1526s21c1
Sequence:CCGGTGTTGAATGCCTGCCTATTTGCTCGAGCAAATAGGCAGGCATTCAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013407.1-1293s21c1
Sequence:CCGGTGCTGAGCCACACAATCATACCTCGAGGTATGATTGTGTGGCTCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013407.1-1501s21c1
Sequence:CCGGTGACCTGGAGGCAGATCAATGCTCGAGCATTGATCTGCCTCCAGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013407.1-970s21c1
Sequence:CCGGCTGTCTGAAGACCTCGTTAAACTCGAGTTTAACGAGGTCTTCAGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)