EMAIL THIS PAGE TO A FRIEND

PRAMEF6

PRAME family member 6

42 Gene Product Result for
UniProtKB ID: Q5VXH4, A0AUJ9
Gene ID:
Mouse(195555) PRAME family member 6
Rat(502997) PRAME family member 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301034 ANTI-PRAMEF6 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001085414 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001085414 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001085414 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001010889 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010889 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010889 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010889 Rosetta Predictions human pricing
XM_001715951 Rosetta Predictions human pricing
XM_001074004 Rosetta Predictions rat pricing
XM_578507 Rosetta Predictions rat pricing
NM_001085414 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010889 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067030 predicted 1020
2 SASI_Hs01_00067033 predicted 970
3 SASI_Hs01_00067034 predicted 808
4 SASI_Hs02_00305854 predicted 768
5 SASI_Hs01_00067028 predicted 1104
6 SASI_Hs01_00067029 predicted 1029
7 SASI_Hs02_00305855 predicted 1361
8 SASI_Hs01_00067032 predicted 1074
9 SASI_Hs02_00305856 predicted 1378
10 SASI_Hs01_00067036 predicted 1089
11 SASI_Hs01_00067031 predicted 821
12 SASI_Hs01_00067035 predicted 1055
13 SASI_Hs01_00067037 predicted 867
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715951 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00407176 predicted 598
2 SASI_Hs02_00407177 predicted 614
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074004 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00344732 predicted 1242
2 SASI_Rn02_00344733 predicted 1061
3 SASI_Rn02_00344734 predicted 625
4 SASI_Rn02_00344735 predicted 960
5 SASI_Rn02_00344736 predicted 1276
6 SASI_Rn02_00344737 predicted 553
7 SASI_Rn02_00344738 predicted 479
8 SASI_Rn02_00344739 predicted 456
9 SASI_Rn02_00344740 predicted 422
10 SASI_Rn02_00344741 predicted 667
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_578507 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00408047 predicted 1244
2 SASI_Rn02_00408048 predicted 1061
3 SASI_Rn02_00408049 predicted 629
4 SASI_Rn02_00408050 predicted 962
5 SASI_Rn02_00408051 predicted 1272
6 SASI_Rn02_00408052 predicted 550
7 SASI_Rn02_00408053 predicted 481
8 SASI_Rn02_00408054 predicted 452
9 SASI_Rn02_00408055 predicted 416
10 SASI_Rn02_00408056 predicted 661
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085414 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300370 predicted 845
2 SASI_Mm02_00300371 predicted 827
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085414
PRAMEF6 MISSION shRNA Bacterial Glycerol Stock
PRAME family member 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085414.2-694s21c1
Sequence:CCGGCAATCCAGGAATTGGCGATAACTCGAGTTATCGCCAATTCCTGGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085414.2-371s21c1
Sequence:CCGGGAACCTACAAGTGCTTGATTTCTCGAGAAATCAAGCACTTGTAGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085414.2-833s21c1
Sequence:CCGGAGAGAAGGAAGCCCTTATTCTCTCGAGAGAATAAGGGCTTCCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085414.2-967s21c1
Sequence:CCGGCATTAGAGACCCTTGCTATTACTCGAGTAATAGCAAGGGTCTCTAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085414.2-506s21c1
Sequence:CCGGGAAACAGACCGTGACTATAAACTCGAGTTTATAGTCACGGTCTGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085414
PRAMEF6 MISSION shRNA shRNA Plasmid DNA
PRAME family member 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085414.2-694s21c1
Sequence:CCGGCAATCCAGGAATTGGCGATAACTCGAGTTATCGCCAATTCCTGGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000270240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085414.2-371s21c1
Sequence:CCGGGAACCTACAAGTGCTTGATTTCTCGAGAAATCAAGCACTTGTAGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000270242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085414.2-833s21c1
Sequence:CCGGAGAGAAGGAAGCCCTTATTCTCTCGAGAGAATAAGGGCTTCCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000270243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085414.2-967s21c1
Sequence:CCGGCATTAGAGACCCTTGCTATTACTCGAGTAATAGCAAGGGTCTCTAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000270197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085414.2-506s21c1
Sequence:CCGGGAAACAGACCGTGACTATAAACTCGAGTTTATAGTCACGGTCTGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085414
PRAMEF6 MISSION shRNA Lentiviral Transduction Particles
PRAME family member 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085414.2-694s21c1
Sequence:CCGGCAATCCAGGAATTGGCGATAACTCGAGTTATCGCCAATTCCTGGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085414.2-371s21c1
Sequence:CCGGGAACCTACAAGTGCTTGATTTCTCGAGAAATCAAGCACTTGTAGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085414.2-833s21c1
Sequence:CCGGAGAGAAGGAAGCCCTTATTCTCTCGAGAGAATAAGGGCTTCCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085414.2-967s21c1
Sequence:CCGGCATTAGAGACCCTTGCTATTACTCGAGTAATAGCAAGGGTCTCTAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085414.2-506s21c1
Sequence:CCGGGAAACAGACCGTGACTATAAACTCGAGTTTATAGTCACGGTCTGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010889
PRAMEF6 MISSION shRNA Bacterial Glycerol Stock
PRAME family member 6
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010889.2-1528s21c1
Sequence:CCGGATTTGGGTGGATATGTCAAACCTCGAGGTTTGACATATCCACCCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010889.1-372s1c1
Sequence:CCGGCTTCCTCAATGCCAAGAGGAACTCGAGTTCCTCTTGGCATTGAGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010889.1-576s1c1
Sequence:CCGGCCGCAATATCAGAAGCATCCTCTCGAGAGGATGCTTCTGATATTGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010889.2-651s21c1
Sequence:CCGGGGAATGCCCTTCCGCAATATCCTCGAGGATATTGCGGAAGGGCATTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010889.2-957s21c1
Sequence:CCGGTGTCTGAAGACCTCGTTAAAGCTCGAGCTTTAACGAGGTCTTCAGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010889.2-1038s21c1
Sequence:CCGGCCGAGTATCAGTCAACTAAAGCTCGAGCTTTAGTTGACTGATACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010889.2-1073s21c1
Sequence:CCGGTGGCATCAGACTGACCAATTACTCGAGTAATTGGTCAGTCTGATGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010889
PRAMEF6 MISSION shRNA shRNA Plasmid DNA
PRAME family member 6
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010889.2-1528s21c1
Sequence:CCGGATTTGGGTGGATATGTCAAACCTCGAGGTTTGACATATCCACCCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010889.1-372s1c1
Sequence:CCGGCTTCCTCAATGCCAAGAGGAACTCGAGTTCCTCTTGGCATTGAGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010889.1-576s1c1
Sequence:CCGGCCGCAATATCAGAAGCATCCTCTCGAGAGGATGCTTCTGATATTGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010889.2-651s21c1
Sequence:CCGGGGAATGCCCTTCCGCAATATCCTCGAGGATATTGCGGAAGGGCATTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010889.2-957s21c1
Sequence:CCGGTGTCTGAAGACCTCGTTAAAGCTCGAGCTTTAACGAGGTCTTCAGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010889.2-1038s21c1
Sequence:CCGGCCGAGTATCAGTCAACTAAAGCTCGAGCTTTAGTTGACTGATACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010889.2-1073s21c1
Sequence:CCGGTGGCATCAGACTGACCAATTACTCGAGTAATTGGTCAGTCTGATGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010889
PRAMEF6 MISSION shRNA Lentiviral Transduction Particles
PRAME family member 6
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010889.2-1528s21c1
Sequence:CCGGATTTGGGTGGATATGTCAAACCTCGAGGTTTGACATATCCACCCAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010889.1-372s1c1
Sequence:CCGGCTTCCTCAATGCCAAGAGGAACTCGAGTTCCTCTTGGCATTGAGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010889.1-576s1c1
Sequence:CCGGCCGCAATATCAGAAGCATCCTCTCGAGAGGATGCTTCTGATATTGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010889.2-651s21c1
Sequence:CCGGGGAATGCCCTTCCGCAATATCCTCGAGGATATTGCGGAAGGGCATTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010889.2-957s21c1
Sequence:CCGGTGTCTGAAGACCTCGTTAAAGCTCGAGCTTTAACGAGGTCTTCAGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010889.2-1038s21c1
Sequence:CCGGCCGAGTATCAGTCAACTAAAGCTCGAGCTTTAGTTGACTGATACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010889.2-1073s21c1
Sequence:CCGGTGGCATCAGACTGACCAATTACTCGAGTAATTGGTCAGTCTGATGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)