EMAIL THIS PAGE TO A FRIEND

PRAMEF7

PRAME family member 7

16 Gene Product Result for
Species: Human PRAMEF7(441871)
UniProtKB ID: Q5VXH5, B9EIP0
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012277 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012277 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012277 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012277 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012277 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138184 predicted 979
2 SASI_Hs01_00138185 predicted 869
3 SASI_Hs01_00138186 predicted 421
4 SASI_Hs01_00138188 predicted 316
5 SASI_Hs01_00138189 predicted 590
6 SASI_Hs01_00138190 predicted 941
7 SASI_Hs01_00138191 predicted 803
8 SASI_Hs01_00138192 predicted 807
9 SASI_Hs01_00138193 predicted 385
10 SASI_Hs02_00306069 predicted 1013
11 SASI_Hs01_00138187 predicted 799
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012277
PRAMEF7 MISSION shRNA Bacterial Glycerol Stock
PRAME family member 7
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012277.1-426s1c1
Sequence:CCGGGCAGCCATTCATGGTGTTCATCTCGAGATGAACACCATGAATGGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012277.1-645s1c1
Sequence:CCGGGCTGTCCACTCTTGTGAAGTTCTCGAGAACTTCACAAGAGTGGACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012277.1-682s1c1
Sequence:CCGGCAGATGAGGAATCTCCGCAAACTCGAGTTTGCGGAGATTCCTCATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012277.1-383s1c1
Sequence:CCGGGTCAGAAGCAAACAGCAGATACTCGAGTATCTGCTGTTTGCTTCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012277.1-325s1c1
Sequence:CCGGGATGAGAACTTCTGCGACATACTCGAGTATGTCGCAGAAGTTCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012277.1-444s1c1
Sequence:CCGGCATAGACCTTTGTCTCAAGAACTCGAGTTCTTGAGACAAAGGTCTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012277
PRAMEF7 MISSION shRNA shRNA Plasmid DNA
PRAME family member 7
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012277.1-426s1c1
Sequence:CCGGGCAGCCATTCATGGTGTTCATCTCGAGATGAACACCATGAATGGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012277.1-645s1c1
Sequence:CCGGGCTGTCCACTCTTGTGAAGTTCTCGAGAACTTCACAAGAGTGGACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012277.1-682s1c1
Sequence:CCGGCAGATGAGGAATCTCCGCAAACTCGAGTTTGCGGAGATTCCTCATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012277.1-383s1c1
Sequence:CCGGGTCAGAAGCAAACAGCAGATACTCGAGTATCTGCTGTTTGCTTCTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012277.1-325s1c1
Sequence:CCGGGATGAGAACTTCTGCGACATACTCGAGTATGTCGCAGAAGTTCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012277.1-444s1c1
Sequence:CCGGCATAGACCTTTGTCTCAAGAACTCGAGTTCTTGAGACAAAGGTCTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012277
PRAMEF7 MISSION shRNA Lentiviral Transduction Particles
PRAME family member 7
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012277.1-426s1c1
Sequence:CCGGGCAGCCATTCATGGTGTTCATCTCGAGATGAACACCATGAATGGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012277.1-645s1c1
Sequence:CCGGGCTGTCCACTCTTGTGAAGTTCTCGAGAACTTCACAAGAGTGGACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012277.1-682s1c1
Sequence:CCGGCAGATGAGGAATCTCCGCAAACTCGAGTTTGCGGAGATTCCTCATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012277.1-383s1c1
Sequence:CCGGGTCAGAAGCAAACAGCAGATACTCGAGTATCTGCTGTTTGCTTCTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012277.1-325s1c1
Sequence:CCGGGATGAGAACTTCTGCGACATACTCGAGTATGTCGCAGAAGTTCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012277.1-444s1c1
Sequence:CCGGCATAGACCTTTGTCTCAAGAACTCGAGTTCTTGAGACAAAGGTCTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)