EMAIL THIS PAGE TO A FRIEND

PRAMEF9

PRAME family member 9

19 Gene Product Result for
Species: Human PRAMEF9(343070)
UniProtKB ID: Q5VWM5, B2RPE1, Q08EQ1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301642 ANTI-PRAMEF9 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010890 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010890 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010890 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010890 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010890 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144127 predicted 1097
2 SASI_Hs01_00144129 predicted 1047
3 SASI_Hs02_00305857 predicted 1587
4 SASI_Hs02_00305858 predicted 1591
5 SASI_Hs01_00144132 predicted 1351
6 SASI_Hs02_00305859 predicted 621
7 SASI_Hs01_00144136 predicted 784
8 SASI_Hs02_00305860 predicted 615
9 SASI_Hs02_00305861 predicted 1102
10 SASI_Hs02_00305862 predicted 1247
11 SASI_Hs01_00144128 predicted 432
12 SASI_Hs01_00144130 predicted 1447
13 SASI_Hs01_00144131 predicted 860
14 SASI_Hs01_00144133 predicted 1398
15 SASI_Hs01_00144134 predicted 977
16 SASI_Hs01_00144135 predicted 436
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010890
PRAMEF9 MISSION shRNA Bacterial Glycerol Stock
PRAME family member 9
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010890.1-1617s21c1
Sequence:CCGGGGAGCACAGAACCCATCATTTCTCGAGAAATGATGGGTTCTGTGCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010890.1-1053s1c1
Sequence:CCGGCGAGTATCAGTCAACTAAAGACTCGAGTCTTTAGTTGACTGATACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010890.1-1051s21c1
Sequence:CCGGCCCGAGTATCAGTCAACTAAACTCGAGTTTAGTTGACTGATACTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010890.1-1501s21c1
Sequence:CCGGTGACCTGGAGGCAGATCAATACTCGAGTATTGATCTGCCTCCAGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010890.1-1089s21c1
Sequence:CCGGGCATCAGACTGACCAATTATACTCGAGTATAATTGGTCAGTCTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010890.1-426s1c1
Sequence:CCGGGTGAGAACTTCTGGATGGTTTCTCGAGAAACCATCCAGAAGTTCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010890.1-536s1c1
Sequence:CCGGCCCTTGACTGTGTTCGTAGAACTCGAGTTCTACGAACACAGTCAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010890.1-664s21c1
Sequence:CCGGGGGAATGCCCTTCCGCAATATCTCGAGATATTGCGGAAGGGCATTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010890
PRAMEF9 MISSION shRNA shRNA Plasmid DNA
PRAME family member 9
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010890.1-1617s21c1
Sequence:CCGGGGAGCACAGAACCCATCATTTCTCGAGAAATGATGGGTTCTGTGCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010890.1-1053s1c1
Sequence:CCGGCGAGTATCAGTCAACTAAAGACTCGAGTCTTTAGTTGACTGATACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010890.1-1051s21c1
Sequence:CCGGCCCGAGTATCAGTCAACTAAACTCGAGTTTAGTTGACTGATACTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010890.1-1501s21c1
Sequence:CCGGTGACCTGGAGGCAGATCAATACTCGAGTATTGATCTGCCTCCAGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010890.1-1089s21c1
Sequence:CCGGGCATCAGACTGACCAATTATACTCGAGTATAATTGGTCAGTCTGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010890.1-426s1c1
Sequence:CCGGGTGAGAACTTCTGGATGGTTTCTCGAGAAACCATCCAGAAGTTCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010890.1-536s1c1
Sequence:CCGGCCCTTGACTGTGTTCGTAGAACTCGAGTTCTACGAACACAGTCAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010890.1-664s21c1
Sequence:CCGGGGGAATGCCCTTCCGCAATATCTCGAGATATTGCGGAAGGGCATTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010890
PRAMEF9 MISSION shRNA Lentiviral Transduction Particles
PRAME family member 9
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010890.1-1617s21c1
Sequence:CCGGGGAGCACAGAACCCATCATTTCTCGAGAAATGATGGGTTCTGTGCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010890.1-1053s1c1
Sequence:CCGGCGAGTATCAGTCAACTAAAGACTCGAGTCTTTAGTTGACTGATACTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010890.1-1051s21c1
Sequence:CCGGCCCGAGTATCAGTCAACTAAACTCGAGTTTAGTTGACTGATACTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010890.1-1501s21c1
Sequence:CCGGTGACCTGGAGGCAGATCAATACTCGAGTATTGATCTGCCTCCAGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010890.1-1089s21c1
Sequence:CCGGGCATCAGACTGACCAATTATACTCGAGTATAATTGGTCAGTCTGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010890.1-426s1c1
Sequence:CCGGGTGAGAACTTCTGGATGGTTTCTCGAGAAACCATCCAGAAGTTCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010890.1-536s1c1
Sequence:CCGGCCCTTGACTGTGTTCGTAGAACTCGAGTTCTACGAACACAGTCAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010890.1-664s21c1
Sequence:CCGGGGGAATGCCCTTCCGCAATATCTCGAGATATTGCGGAAGGGCATTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)