EMAIL THIS PAGE TO A FRIEND

PRAP1

proline-rich acidic protein 1

47 Gene Product Result for
Synonyms: PRO1195 RP11-122K13.6 UPA
Gene ID:
Mouse(22264) proline-rich acidic protein 1
Rat(60574) proline-rich acidic protein 1
cow(512786) proline-rich acidic protein 1
naked mole-rat(101697781) proline-rich acidic protein 1
chicken(770818) proline-rich acidic protein 1
dog(608254) proline-rich acidic protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009475 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009475 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009475 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145202 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145202 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145202 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145202 Rosetta Predictions human pricing
NM_031669 Rosetta Predictions rat pricing
NM_009475 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145202 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128718 predicted 218
2 SASI_Hs01_00128719 predicted 324
3 SASI_Hs01_00128720 predicted 322
4 SASI_Hs01_00128721 predicted 294
5 SASI_Hs01_00128723 predicted 300
6 SASI_Hs01_00128724 predicted 343
7 SASI_Hs01_00128722 predicted 194
8 SASI_Hs01_00128725 predicted 188
9 SASI_Hs01_00128726 predicted 90
10 SASI_Hs01_00128727 predicted 81
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031669 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265011 predicted 291
2 SASI_Rn01_00084661 predicted 227
3 SASI_Rn01_00084662 predicted 321
4 SASI_Rn01_00084663 predicted 314
5 SASI_Rn01_00084664 predicted 321
6 SASI_Rn01_00084665 predicted 343
7 SASI_Rn01_00084666 predicted 220
8 SASI_Rn01_00084667 predicted 317
9 SASI_Rn01_00084668 predicted 250
10 SASI_Rn01_00084669 predicted 372
11 SASI_Rn01_00084660 predicted 264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009475 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064938 predicted 295
2 SASI_Mm01_00064939 predicted 352
3 SASI_Mm01_00064940 predicted 366
4 SASI_Mm01_00064941 predicted 306
5 SASI_Mm01_00064942 predicted 330
6 SASI_Mm01_00064943 predicted 359
7 SASI_Mm02_00316203 predicted 245
8 SASI_Mm01_00064944 predicted 324
9 SASI_Mm01_00064945 predicted 247
10 SASI_Mm01_00064947 predicted 315
11 SASI_Mm01_00064946 predicted 290
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009475
PRAP1 MISSION shRNA Bacterial Glycerol Stock
proline-rich acidic protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009475.2-369s21c1
Sequence:CCGGCTGGATCTTGACAGCATAGACCTCGAGGTCTATGCTGTCAAGATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009475.2-311s21c1
Sequence:CCGGCTGGGTGGAGACTGAGGATATCTCGAGATATCCTCAGTCTCCACCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009475.2-139s21c1
Sequence:CCGGAGGTCCCTGTCAAGACCAAAGCTCGAGCTTTGGTCTTGACAGGGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009475.2-188s21c1
Sequence:CCGGAGAGAAGGTCTGGGATACTAGCTCGAGCTAGTATCCCAGACCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009475.1-382s1c1
Sequence:CCGGCATAGACCATCCCATGTCTGACTCGAGTCAGACATGGGATGGTCTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009475.1-365s1c1
Sequence:CCGGGAACTGGATCTTGACAGCATACTCGAGTATGCTGTCAAGATCCAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009475.1-148s1c1
Sequence:CCGGCAAGACCAAAGGCAAACATGTCTCGAGACATGTTTGCCTTTGGTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009475.1-401s1c1
Sequence:CCGGGACGATGTCCAGGATGAAGAACTCGAGTTCTTCATCCTGGACATCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009475.1-182s1c1
Sequence:CCGGGAAACAGAGAAGGTCTGGGATCTCGAGATCCCAGACCTTCTCTGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009475.1-371s1c1
Sequence:CCGGGATCTTGACAGCATAGACCATCTCGAGATGGTCTATGCTGTCAAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009475
PRAP1 MISSION shRNA shRNA Plasmid DNA
proline-rich acidic protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009475.2-369s21c1
Sequence:CCGGCTGGATCTTGACAGCATAGACCTCGAGGTCTATGCTGTCAAGATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009475.2-311s21c1
Sequence:CCGGCTGGGTGGAGACTGAGGATATCTCGAGATATCCTCAGTCTCCACCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009475.2-139s21c1
Sequence:CCGGAGGTCCCTGTCAAGACCAAAGCTCGAGCTTTGGTCTTGACAGGGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009475.2-188s21c1
Sequence:CCGGAGAGAAGGTCTGGGATACTAGCTCGAGCTAGTATCCCAGACCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009475.1-382s1c1
Sequence:CCGGCATAGACCATCCCATGTCTGACTCGAGTCAGACATGGGATGGTCTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009475.1-365s1c1
Sequence:CCGGGAACTGGATCTTGACAGCATACTCGAGTATGCTGTCAAGATCCAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009475.1-148s1c1
Sequence:CCGGCAAGACCAAAGGCAAACATGTCTCGAGACATGTTTGCCTTTGGTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009475.1-401s1c1
Sequence:CCGGGACGATGTCCAGGATGAAGAACTCGAGTTCTTCATCCTGGACATCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009475.1-182s1c1
Sequence:CCGGGAAACAGAGAAGGTCTGGGATCTCGAGATCCCAGACCTTCTCTGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009475.1-371s1c1
Sequence:CCGGGATCTTGACAGCATAGACCATCTCGAGATGGTCTATGCTGTCAAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009475
PRAP1 MISSION shRNA Lentiviral Transduction Particles
proline-rich acidic protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009475.2-369s21c1
Sequence:CCGGCTGGATCTTGACAGCATAGACCTCGAGGTCTATGCTGTCAAGATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009475.2-311s21c1
Sequence:CCGGCTGGGTGGAGACTGAGGATATCTCGAGATATCCTCAGTCTCCACCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009475.2-139s21c1
Sequence:CCGGAGGTCCCTGTCAAGACCAAAGCTCGAGCTTTGGTCTTGACAGGGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009475.2-188s21c1
Sequence:CCGGAGAGAAGGTCTGGGATACTAGCTCGAGCTAGTATCCCAGACCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009475.1-382s1c1
Sequence:CCGGCATAGACCATCCCATGTCTGACTCGAGTCAGACATGGGATGGTCTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009475.1-365s1c1
Sequence:CCGGGAACTGGATCTTGACAGCATACTCGAGTATGCTGTCAAGATCCAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009475.1-148s1c1
Sequence:CCGGCAAGACCAAAGGCAAACATGTCTCGAGACATGTTTGCCTTTGGTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009475.1-401s1c1
Sequence:CCGGGACGATGTCCAGGATGAAGAACTCGAGTTCTTCATCCTGGACATCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009475.1-182s1c1
Sequence:CCGGGAAACAGAGAAGGTCTGGGATCTCGAGATCCCAGACCTTCTCTGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009475.1-371s1c1
Sequence:CCGGGATCTTGACAGCATAGACCATCTCGAGATGGTCTATGCTGTCAAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145202
PRAP1 MISSION shRNA Bacterial Glycerol Stock
proline-rich acidic protein 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145202.3-77s21c1
Sequence:CCGGAGCACCCAAGGTCCCTATCAACTCGAGTTGATAGGGACCTTGGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145202.3-218s21c1
Sequence:CCGGACTCTTGACCACCGAGGAGAACTCGAGTTCTCCTCGGTGGTCAAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145202.3-91s21c1
Sequence:CCGGCTATCAAGATGCAAGTCAAACCTCGAGGTTTGACTTGCATCTTGATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145202.3-203s21c1
Sequence:CCGGTGTCCAGAAGCCGAAACTCTTCTCGAGAAGAGTTTCGGCTTCTGGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145202.2-99s1c1
Sequence:CCGGCCTATCAAGATGCAAGTCAAACTCGAGTTTGACTTGCATCTTGATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145202.2-96s1c1
Sequence:CCGGGTCCCTATCAAGATGCAAGTCCTCGAGGACTTGCATCTTGATAGGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145202
PRAP1 MISSION shRNA shRNA Plasmid DNA
proline-rich acidic protein 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145202.3-77s21c1
Sequence:CCGGAGCACCCAAGGTCCCTATCAACTCGAGTTGATAGGGACCTTGGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145202.3-218s21c1
Sequence:CCGGACTCTTGACCACCGAGGAGAACTCGAGTTCTCCTCGGTGGTCAAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145202.3-91s21c1
Sequence:CCGGCTATCAAGATGCAAGTCAAACCTCGAGGTTTGACTTGCATCTTGATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145202.3-203s21c1
Sequence:CCGGTGTCCAGAAGCCGAAACTCTTCTCGAGAAGAGTTTCGGCTTCTGGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145202.2-99s1c1
Sequence:CCGGCCTATCAAGATGCAAGTCAAACTCGAGTTTGACTTGCATCTTGATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145202.2-96s1c1
Sequence:CCGGGTCCCTATCAAGATGCAAGTCCTCGAGGACTTGCATCTTGATAGGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145202
PRAP1 MISSION shRNA Lentiviral Transduction Particles
proline-rich acidic protein 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145202.3-77s21c1
Sequence:CCGGAGCACCCAAGGTCCCTATCAACTCGAGTTGATAGGGACCTTGGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145202.3-218s21c1
Sequence:CCGGACTCTTGACCACCGAGGAGAACTCGAGTTCTCCTCGGTGGTCAAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145202.3-91s21c1
Sequence:CCGGCTATCAAGATGCAAGTCAAACCTCGAGGTTTGACTTGCATCTTGATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145202.3-203s21c1
Sequence:CCGGTGTCCAGAAGCCGAAACTCTTCTCGAGAAGAGTTTCGGCTTCTGGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145202.2-99s1c1
Sequence:CCGGCCTATCAAGATGCAAGTCAAACTCGAGTTTGACTTGCATCTTGATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145202.2-96s1c1
Sequence:CCGGGTCCCTATCAAGATGCAAGTCCTCGAGGACTTGCATCTTGATAGGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)