EMAIL THIS PAGE TO A FRIEND

PRB2

proline-rich protein BstNI subfamily 2

41 Gene Product Result for
Synonyms: IB-9 PRPPRB1 Ps cP7
Species: Human PRB2(653247)
UniProtKB ID: P02812, O00599, P02811, P04281
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301068 ANTI-PRB2 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006248 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006248 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006248 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006248 Rosetta Predictions human pricing
XM_932546 Rosetta Predictions human pricing
XM_932550 Rosetta Predictions human pricing
XM_932556 Rosetta Predictions human pricing
XM_932561 Rosetta Predictions human pricing
XM_932567 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006248 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341173 predicted 481
2 SASI_Hs02_00341174 predicted 856
3 SASI_Hs02_00341175 predicted 838
4 SASI_Hs02_00341176 predicted 465
5 SASI_Hs02_00341177 predicted 838
6 SASI_Hs02_00341178 predicted 652
7 SASI_Hs02_00341179 predicted 472
8 SASI_Hs01_00166483 predicted 1098
9 SASI_Hs01_00166484 predicted 1102
10 SASI_Hs01_00166485 predicted 1091
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932546 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00283764 predicted 337
2 SASI_Hs01_00283765 predicted 737
3 SASI_Hs01_00283766 predicted 736
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932550 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00301637 predicted 484
2 SASI_Hs01_00301638 predicted 477
3 SASI_Hs01_00301639 predicted 469
4 SASI_Hs01_00301640 predicted 464
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932556 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00289695 predicted 484
2 SASI_Hs01_00289696 predicted 478
3 SASI_Hs01_00289697 predicted 473
4 SASI_Hs01_00289698 predicted 462
5 SASI_Hs01_00289699 predicted 522
6 SASI_Hs01_00289700 predicted 921
7 SASI_Hs01_00289701 predicted 920
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932561 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00272813 predicted 339
2 SASI_Hs01_00272814 predicted 676
3 SASI_Hs01_00272815 predicted 677
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932567 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00255297 predicted 660
2 SASI_Hs01_00255298 predicted 655
3 SASI_Hs01_00255299 predicted 667
4 SASI_Hs01_00255300 predicted 659
5 SASI_Hs01_00255301 predicted 461
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006248
PRB2 MISSION shRNA Bacterial Glycerol Stock
proline-rich protein BstNI subfamily 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000183583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006248.1-1058s1c1
Sequence:CCGGGAATAAGAAGATGAGAGTGATCTCGAGATCACTCTCATCTTCTTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006248.1-1040s1c1
Sequence:CCGGGATTCAATGACAGGAAGTGAACTCGAGTTCACTTCCTGTCATTGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006248.1-77s1c1
Sequence:CCGGCTTAAATGAAGATGTCAGCCACTCGAGTGGCTGACATCTTCATTTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006248.1-451s1c1
Sequence:CCGGCACAAGGAGACAAGTCCCAAACTCGAGTTTGGGACTTGTCTCCTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006248
PRB2 MISSION shRNA shRNA Plasmid DNA
proline-rich protein BstNI subfamily 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000183583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006248.1-1058s1c1
Sequence:CCGGGAATAAGAAGATGAGAGTGATCTCGAGATCACTCTCATCTTCTTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006248.1-1040s1c1
Sequence:CCGGGATTCAATGACAGGAAGTGAACTCGAGTTCACTTCCTGTCATTGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006248.1-77s1c1
Sequence:CCGGCTTAAATGAAGATGTCAGCCACTCGAGTGGCTGACATCTTCATTTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006248.1-451s1c1
Sequence:CCGGCACAAGGAGACAAGTCCCAAACTCGAGTTTGGGACTTGTCTCCTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006248
PRB2 MISSION shRNA Lentiviral Transduction Particles
proline-rich protein BstNI subfamily 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000183583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006248.1-1058s1c1
Sequence:CCGGGAATAAGAAGATGAGAGTGATCTCGAGATCACTCTCATCTTCTTATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006248.1-1040s1c1
Sequence:CCGGGATTCAATGACAGGAAGTGAACTCGAGTTCACTTCCTGTCATTGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006248.1-77s1c1
Sequence:CCGGCTTAAATGAAGATGTCAGCCACTCGAGTGGCTGACATCTTCATTTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006248.1-451s1c1
Sequence:CCGGCACAAGGAGACAAGTCCCAAACTCGAGTTTGGGACTTGTCTCCTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)