EMAIL THIS PAGE TO A FRIEND

PRB4

proline-rich protein BstNI subfamily 4

18 Gene Product Result for
Synonyms: Po
Species: Human PRB4(5545)
Gene ID:
Human(5545) Summary: The protein encoded by this gene is a proline-rich salivary protein. This gene and five other genes that also encode salivary proline-rich proteins (PRPs), as well as a gene encoding a lacrimal gland PRP, form a PRP gene cluster in the chromosomal 12p13 region. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002723 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002723 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002723 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002723 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002723 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228573 predicted 110
2 SASI_Hs01_00228574 predicted 845
3 SASI_Hs01_00228576 predicted 66
4 SASI_Hs01_00228578 predicted 839
5 SASI_Hs01_00228579 predicted 64
6 SASI_Hs01_00228580 predicted 71
7 SASI_Hs01_00228581 predicted 799
8 SASI_Hs02_00334322 predicted 104
9 SASI_Hs02_00334323 predicted 836
10 SASI_Hs01_00228572 predicted 739
11 SASI_Hs01_00228575 predicted 809
12 SASI_Hs01_00228577 predicted 112
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002723
PRB4 MISSION shRNA Bacterial Glycerol Stock
proline-rich protein BstNI subfamily 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002723.3-537s1c1
Sequence:CCGGAGGAAGGAAACAAGTCCCGAACTCGAGTTCGGGACTTGTTTCCTTCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021924    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002723.3-794s1c1
Sequence:CCGGCAGGAAGTGAATAAGAAGATACTCGAGTATCTTCTTATTCACTTCCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002723.3-317s1c1
Sequence:CCGGCATCCAGGAAAGCCAGAAAGACTCGAGTCTTTCTGGCTTTCCTGGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002723.3-779s1c1
Sequence:CCGGTCTAGGATTCAATGACAGGAACTCGAGTTCCTGTCATTGAATCCTAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002723.3-116s1c1
Sequence:CCGGTCTCTCTTCCTAATATCAGGACTCGAGTCCTGATATTAGGAAGAGAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002723
PRB4 MISSION shRNA shRNA Plasmid DNA
proline-rich protein BstNI subfamily 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002723.3-537s1c1
Sequence:CCGGAGGAAGGAAACAAGTCCCGAACTCGAGTTCGGGACTTGTTTCCTTCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021924    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002723.3-794s1c1
Sequence:CCGGCAGGAAGTGAATAAGAAGATACTCGAGTATCTTCTTATTCACTTCCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002723.3-317s1c1
Sequence:CCGGCATCCAGGAAAGCCAGAAAGACTCGAGTCTTTCTGGCTTTCCTGGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002723.3-779s1c1
Sequence:CCGGTCTAGGATTCAATGACAGGAACTCGAGTTCCTGTCATTGAATCCTAGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002723.3-116s1c1
Sequence:CCGGTCTCTCTTCCTAATATCAGGACTCGAGTCCTGATATTAGGAAGAGAGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002723
PRB4 MISSION shRNA Lentiviral Transduction Particles
proline-rich protein BstNI subfamily 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002723.3-537s1c1
Sequence:CCGGAGGAAGGAAACAAGTCCCGAACTCGAGTTCGGGACTTGTTTCCTTCCTTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000021924    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002723.3-794s1c1
Sequence:CCGGCAGGAAGTGAATAAGAAGATACTCGAGTATCTTCTTATTCACTTCCTGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000021926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002723.3-317s1c1
Sequence:CCGGCATCCAGGAAAGCCAGAAAGACTCGAGTCTTTCTGGCTTTCCTGGATGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000021927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002723.3-779s1c1
Sequence:CCGGTCTAGGATTCAATGACAGGAACTCGAGTTCCTGTCATTGAATCCTAGATTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000021928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002723.3-116s1c1
Sequence:CCGGTCTCTCTTCCTAATATCAGGACTCGAGTCCTGATATTAGGAAGAGAGATTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???