EMAIL THIS PAGE TO A FRIEND

PRC1

protein regulator of cytokinesis 1

81 Gene Product Result for
Synonyms: ASE1
UniProtKB ID: O43663, A6NC44, B4DLR1, Q9BSB6
Gene ID:
Human(9055) Summary: This gene encodes a protein that is involved in cytokinesis. The protein is present at high levels during the S and G2/M phases of mitosis but its levels drop dramatically when the cell exits mitosis and enters the G1 phase. It is located in the nucleus during interphase, becomes associated with mitotic spindles in a highly dynamic manner during mitosis, and localizes to the cell mid-body during cytokinesis. This protein has been shown to be a substrate of several cyclin-dependent kinases (CDKs). It is necessary for polarizing parallel microtubules and concentrating the factors responsible for contractile ring assembly. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
Mouse(233406) protein regulator of cytokinesis 1
Rat(308761) protein regulator of cytokinesis 1
chicken(770336) protein regulator of cytokinesis 1
Horse(100069001) protein regulator of cytokinesis 1
domestic cat(101088580) protein regulator of cytokinesis 1
dog(488742) protein regulator of cytokinesis 1
cow(767818) protein regulator of cytokinesis 1
sheep(101103846) protein regulator of cytokinesis 1
naked mole-rat(101713486) protein regulator of cytokinesis 1
Domestic Rabbit(100346153) protein regulator of cytokinesis 1
domestic guinea pig(100728356) protein regulator of cytokinesis 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003981 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003981 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003981 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145150 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145150 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145150 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU100971 MISSION® esiRNA esiRNA human PRC1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003981 Rosetta Predictions human pricing
NM_199413 Rosetta Predictions human pricing
NM_199414 Rosetta Predictions human pricing
NM_001107529 Rosetta Predictions rat pricing
NM_145150 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003981 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336676 predicted 651
2 SASI_Hs01_00183875 predicted 612
3 SASI_Hs02_00336677 predicted 1109
4 SASI_Hs01_00183876 predicted 1409
5 SASI_Hs01_00183877 predicted 538
6 SASI_Hs01_00183878 predicted 628
7 SASI_Hs01_00183881 predicted 540
8 SASI_Hs01_00183882 predicted 358
9 SASI_Hs01_00183883 predicted 1442
10 SASI_Hs01_00183884 predicted 932
11 SASI_Hs01_00183879 predicted 1135
12 SASI_Hs01_00183880 predicted 399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199413 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372807 predicted 658
2 SASI_Hs01_00080625 predicted 618
3 SASI_Hs02_00372808 predicted 1113
4 SASI_Hs01_00080626 predicted 1410
5 SASI_Hs01_00080627 predicted 532
6 SASI_Hs01_00080628 predicted 625
7 SASI_Hs01_00080631 predicted 544
8 SASI_Hs01_00080632 predicted 352
9 SASI_Hs01_00080633 predicted 1434
10 SASI_Hs01_00080634 predicted 930
11 SASI_Hs01_00080629 predicted 1139
12 SASI_Hs01_00080630 predicted 399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199414 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372809 predicted 657
2 SASI_Hs01_00128728 predicted 610
3 SASI_Hs02_00372810 predicted 1111
4 SASI_Hs01_00128729 predicted 1409
5 SASI_Hs01_00128730 predicted 529
6 SASI_Hs01_00128731 predicted 628
7 SASI_Hs01_00128734 predicted 542
8 SASI_Hs01_00128735 predicted 352
9 SASI_Hs01_00128736 predicted 1440
10 SASI_Hs01_00128737 predicted 932
11 SASI_Hs01_00128732 predicted 1136
12 SASI_Hs01_00128733 predicted 401
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107529 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229725 predicted 643
2 SASI_Rn02_00229726 predicted 610
3 SASI_Rn02_00229727 predicted 637
4 SASI_Rn02_00229728 predicted 520
5 SASI_Rn02_00229729 predicted 597
6 SASI_Rn02_00229730 predicted 1076
7 SASI_Rn02_00229731 predicted 753
8 SASI_Rn02_00229732 predicted 1913
9 SASI_Rn02_00229733 predicted 2024
10 SASI_Rn02_00229734 predicted 1944
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145150 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340556 predicted 1423
2 SASI_Mm02_00340557 predicted 898
3 SASI_Mm02_00340558 predicted 252
4 SASI_Mm02_00340559 predicted 637
5 SASI_Mm02_00340560 predicted 647
6 SASI_Mm02_00340561 predicted 1370
7 SASI_Mm02_00340562 predicted 629
8 SASI_Mm02_00340563 predicted 1071
9 SASI_Mm02_00340564 predicted 427
10 SASI_Mm02_00340565 predicted 224
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003981
VALIDATED
PRC1 MISSION shRNA Bacterial Glycerol Stock
protein regulator of cytokinesis 1
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166004    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003981.2-2277s1c1
Sequence:CCGGGCCTGACTTCTCTACCACATACTCGAGTATGTGGTAGAGAAGTCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159416    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003981.2-2147s1c1
Sequence:CCGGGCCTAACTTAAAGATGTGAATCTCGAGATTCACATCTTTAAGTTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003981.2-1400s1c1
Sequence:CCGGCAGGAACATTCAAAGGCATTTCTCGAGAAATGCCTTTGAATGTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003981.2-695s1c1
Sequence:CCGGCAGATCATACTGTGTATGGAACTCGAGTTCCATACACAGTATGATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159775    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003981.2-2587s1c1
Sequence:CCGGGCAGCTTTGTTAAATTGTGTTCTCGAGAACACAATTTAACAAAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162697    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003981.2-2507s1c1
Sequence:CCGGCCTCCTGAAGAGAATGTCTTTCTCGAGAAAGACATTCTCTTCAGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003981.2-337s1c1
Sequence:CCGGCCTGAAGGAAAGACTCATCAACTCGAGTTGATGAGTCTTTCCTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003981.2-1379s1c1
Sequence:CCGGGCACGAATTGAATTGTGGGAACTCGAGTTCCCACAATTCAATTCGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003981.2-399s1c1
Sequence:CCGGGCGAGTTACATGTTGAGCCATCTCGAGATGGCTCAACATGTAACTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003981.2-977s1c1
Sequence:CCGGGCGCTGCAATTAGAAGTGGATCTCGAGATCCACTTCTAATTGCAGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280717    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003981.2-2507s21c1
Sequence:CCGGCCTCCTGAAGAGAATGTCTTTCTCGAGAAAGACATTCTCTTCAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003981.2-399s21c1
Sequence:CCGGGCGAGTTACATGTTGAGCCATCTCGAGATGGCTCAACATGTAACTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003981.2-337s21c1
Sequence:CCGGCCTGAAGGAAAGACTCATCAACTCGAGTTGATGAGTCTTTCCTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280792    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003981.2-2277s21c1
Sequence:CCGGGCCTGACTTCTCTACCACATACTCGAGTATGTGGTAGAGAAGTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003981.2-1400s21c1
Sequence:CCGGCAGGAACATTCAAAGGCATTTCTCGAGAAATGCCTTTGAATGTTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003981
VALIDATED
PRC1 MISSION shRNA shRNA Plasmid DNA
protein regulator of cytokinesis 1
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166004    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003981.2-2277s1c1
Sequence:CCGGGCCTGACTTCTCTACCACATACTCGAGTATGTGGTAGAGAAGTCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159416    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003981.2-2147s1c1
Sequence:CCGGGCCTAACTTAAAGATGTGAATCTCGAGATTCACATCTTTAAGTTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003981.2-1400s1c1
Sequence:CCGGCAGGAACATTCAAAGGCATTTCTCGAGAAATGCCTTTGAATGTTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003981.2-695s1c1
Sequence:CCGGCAGATCATACTGTGTATGGAACTCGAGTTCCATACACAGTATGATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159775    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003981.2-2587s1c1
Sequence:CCGGGCAGCTTTGTTAAATTGTGTTCTCGAGAACACAATTTAACAAAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162697    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003981.2-2507s1c1
Sequence:CCGGCCTCCTGAAGAGAATGTCTTTCTCGAGAAAGACATTCTCTTCAGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003981.2-337s1c1
Sequence:CCGGCCTGAAGGAAAGACTCATCAACTCGAGTTGATGAGTCTTTCCTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003981.2-1379s1c1
Sequence:CCGGGCACGAATTGAATTGTGGGAACTCGAGTTCCCACAATTCAATTCGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003981.2-399s1c1
Sequence:CCGGGCGAGTTACATGTTGAGCCATCTCGAGATGGCTCAACATGTAACTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003981.2-977s1c1
Sequence:CCGGGCGCTGCAATTAGAAGTGGATCTCGAGATCCACTTCTAATTGCAGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280717    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003981.2-2507s21c1
Sequence:CCGGCCTCCTGAAGAGAATGTCTTTCTCGAGAAAGACATTCTCTTCAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003981.2-399s21c1
Sequence:CCGGGCGAGTTACATGTTGAGCCATCTCGAGATGGCTCAACATGTAACTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003981.2-337s21c1
Sequence:CCGGCCTGAAGGAAAGACTCATCAACTCGAGTTGATGAGTCTTTCCTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280792    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003981.2-2277s21c1
Sequence:CCGGGCCTGACTTCTCTACCACATACTCGAGTATGTGGTAGAGAAGTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003981.2-1400s21c1
Sequence:CCGGCAGGAACATTCAAAGGCATTTCTCGAGAAATGCCTTTGAATGTTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003981
VALIDATED
PRC1 MISSION shRNA Lentiviral Transduction Particles
protein regulator of cytokinesis 1
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166004    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003981.2-2277s1c1
Sequence:CCGGGCCTGACTTCTCTACCACATACTCGAGTATGTGGTAGAGAAGTCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159416    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003981.2-2147s1c1
Sequence:CCGGGCCTAACTTAAAGATGTGAATCTCGAGATTCACATCTTTAAGTTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003981.2-1400s1c1
Sequence:CCGGCAGGAACATTCAAAGGCATTTCTCGAGAAATGCCTTTGAATGTTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003981.2-695s1c1
Sequence:CCGGCAGATCATACTGTGTATGGAACTCGAGTTCCATACACAGTATGATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159775    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003981.2-2587s1c1
Sequence:CCGGGCAGCTTTGTTAAATTGTGTTCTCGAGAACACAATTTAACAAAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162697    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003981.2-2507s1c1
Sequence:CCGGCCTCCTGAAGAGAATGTCTTTCTCGAGAAAGACATTCTCTTCAGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003981.2-337s1c1
Sequence:CCGGCCTGAAGGAAAGACTCATCAACTCGAGTTGATGAGTCTTTCCTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003981.2-1379s1c1
Sequence:CCGGGCACGAATTGAATTGTGGGAACTCGAGTTCCCACAATTCAATTCGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003981.2-399s1c1
Sequence:CCGGGCGAGTTACATGTTGAGCCATCTCGAGATGGCTCAACATGTAACTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003981.2-977s1c1
Sequence:CCGGGCGCTGCAATTAGAAGTGGATCTCGAGATCCACTTCTAATTGCAGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280717    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003981.2-2507s21c1
Sequence:CCGGCCTCCTGAAGAGAATGTCTTTCTCGAGAAAGACATTCTCTTCAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003981.2-399s21c1
Sequence:CCGGGCGAGTTACATGTTGAGCCATCTCGAGATGGCTCAACATGTAACTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003981.2-337s21c1
Sequence:CCGGCCTGAAGGAAAGACTCATCAACTCGAGTTGATGAGTCTTTCCTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280792    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003981.2-2277s21c1
Sequence:CCGGGCCTGACTTCTCTACCACATACTCGAGTATGTGGTAGAGAAGTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003981.2-1400s21c1
Sequence:CCGGCAGGAACATTCAAAGGCATTTCTCGAGAAATGCCTTTGAATGTTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145150
VALIDATED
PRC1 MISSION shRNA Bacterial Glycerol Stock
protein regulator of cytokinesis 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000190626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145150.1-373s1c1
Sequence:CCGGGCGCACTCAAGTAGAATTGATCTCGAGATCAATTCTACTTGAGTGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145150.2-2142s21c1
Sequence:CCGGTGATTCAAGAGAGACCTTAAACTCGAGTTTAAGGTCTCTCTTGAATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145150.2-171s21c1
Sequence:CCGGCTAACTCACCTCCGGGAAATACTCGAGTATTTCCCGGAGGTGAGTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340488    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145150.2-2793s21c1
Sequence:CCGGCTTTGCACATCTACAAGTTATCTCGAGATAACTTGTAGATGTGCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145150.2-1120s21c1
Sequence:CCGGATGCCGAGATTGTACGGTTAACTCGAGTTAACCGTACAATCTCGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215814    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_145150.2-2793s1c1
Sequence:CCGGCTTTGCACATCTACAAGTTATCTCGAGATAACTTGTAGATGTGCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145150.2-1897s1c1
Sequence:CCGGCTACGTCTCGAATCCTCAATTCTCGAGAATTGAGGATTCGAGACGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219541    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_145150.1-2081s1c1
Sequence:CCGGTGATTCAAGAGAGACCTTAAACTCGAGTTTAAGGTCTCTCTTGAATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_145150.1-1068s1c1
Sequence:CCGGATGCCGAGATTGTACGGTTAACTCGAGTTAACCGTACAATCTCGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145150.1-836s1c1
Sequence:CCGGGAGCCTGTGGAGGCAATTATGCTCGAGCATAATTGCCTCCACAGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_145150.1-119s1c1
Sequence:CCGGCTAACTCACCTCCGGGAAATACTCGAGTATTTCCCGGAGGTGAGTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145150.2-1835s21c1
Sequence:CCGGGTCTGTTGCCAGCACCTATTCCTCGAGGAATAGGTGCTGGCAACAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145150
VALIDATED
PRC1 MISSION shRNA shRNA Plasmid DNA
protein regulator of cytokinesis 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000190626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145150.1-373s1c1
Sequence:CCGGGCGCACTCAAGTAGAATTGATCTCGAGATCAATTCTACTTGAGTGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145150.2-2142s21c1
Sequence:CCGGTGATTCAAGAGAGACCTTAAACTCGAGTTTAAGGTCTCTCTTGAATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145150.2-171s21c1
Sequence:CCGGCTAACTCACCTCCGGGAAATACTCGAGTATTTCCCGGAGGTGAGTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340488    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145150.2-2793s21c1
Sequence:CCGGCTTTGCACATCTACAAGTTATCTCGAGATAACTTGTAGATGTGCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145150.2-1120s21c1
Sequence:CCGGATGCCGAGATTGTACGGTTAACTCGAGTTAACCGTACAATCTCGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215814    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_145150.2-2793s1c1
Sequence:CCGGCTTTGCACATCTACAAGTTATCTCGAGATAACTTGTAGATGTGCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145150.2-1897s1c1
Sequence:CCGGCTACGTCTCGAATCCTCAATTCTCGAGAATTGAGGATTCGAGACGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219541    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_145150.1-2081s1c1
Sequence:CCGGTGATTCAAGAGAGACCTTAAACTCGAGTTTAAGGTCTCTCTTGAATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_145150.1-1068s1c1
Sequence:CCGGATGCCGAGATTGTACGGTTAACTCGAGTTAACCGTACAATCTCGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145150.1-836s1c1
Sequence:CCGGGAGCCTGTGGAGGCAATTATGCTCGAGCATAATTGCCTCCACAGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_145150.1-119s1c1
Sequence:CCGGCTAACTCACCTCCGGGAAATACTCGAGTATTTCCCGGAGGTGAGTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145150.2-1835s21c1
Sequence:CCGGGTCTGTTGCCAGCACCTATTCCTCGAGGAATAGGTGCTGGCAACAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145150
VALIDATED
PRC1 MISSION shRNA Lentiviral Transduction Particles
protein regulator of cytokinesis 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000190626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145150.1-373s1c1
Sequence:CCGGGCGCACTCAAGTAGAATTGATCTCGAGATCAATTCTACTTGAGTGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145150.2-2142s21c1
Sequence:CCGGTGATTCAAGAGAGACCTTAAACTCGAGTTTAAGGTCTCTCTTGAATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145150.2-171s21c1
Sequence:CCGGCTAACTCACCTCCGGGAAATACTCGAGTATTTCCCGGAGGTGAGTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340488    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145150.2-2793s21c1
Sequence:CCGGCTTTGCACATCTACAAGTTATCTCGAGATAACTTGTAGATGTGCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145150.2-1120s21c1
Sequence:CCGGATGCCGAGATTGTACGGTTAACTCGAGTTAACCGTACAATCTCGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215814    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_145150.2-2793s1c1
Sequence:CCGGCTTTGCACATCTACAAGTTATCTCGAGATAACTTGTAGATGTGCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145150.2-1897s1c1
Sequence:CCGGCTACGTCTCGAATCCTCAATTCTCGAGAATTGAGGATTCGAGACGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219541    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_145150.1-2081s1c1
Sequence:CCGGTGATTCAAGAGAGACCTTAAACTCGAGTTTAAGGTCTCTCTTGAATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_145150.1-1068s1c1
Sequence:CCGGATGCCGAGATTGTACGGTTAACTCGAGTTAACCGTACAATCTCGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145150.1-836s1c1
Sequence:CCGGGAGCCTGTGGAGGCAATTATGCTCGAGCATAATTGCCTCCACAGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_145150.1-119s1c1
Sequence:CCGGCTAACTCACCTCCGGGAAATACTCGAGTATTTCCCGGAGGTGAGTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145150.2-1835s21c1
Sequence:CCGGGTCTGTTGCCAGCACCTATTCCTCGAGGAATAGGTGCTGGCAACAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)