PRC1

protein regulator of cytokinesis 1

81 Gene Product Result for

Synonyms: ASE1

Species: Human PRC1(9055), Mouse Prc1(233406), Rat Prc1(308761), chicken PRC1(770336), Horse PRC1(100069001), domestic cat PRC1(101088580), dog PRC1(488742), cow PRC1(767818), sheep PRC1(101103846), naked mole-rat Prc1(101713486), Domestic Rabbit PRC1(100346153), domestic guinea pig Prc1(100728356)

UniProtKB ID: O43663, A6NC44, B4DLR1, Q9BSB6

Gene ID:

Human(9055) Summary: This gene encodes a protein that is involved in cytokinesis. The protein is present at high levels during the S and G2/M phases of mitosis but its levels drop dramatically when the cell exits mitosis and enters the G1 phase. It is located in the nucleus during interphase, becomes associated with mitotic spindles in a highly dynamic manner during mitosis, and localizes to the cell mid-body during cytokinesis. This protein has been shown to be a substrate of several cyclin-dependent kinases (CDKs). It is necessary for polarizing parallel microtubules and concentrating the factors responsible for contractile ring assembly. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]

Mouse(233406) protein regulator of cytokinesis 1

Rat(308761) protein regulator of cytokinesis 1

chicken(770336) protein regulator of cytokinesis 1

Horse(100069001) protein regulator of cytokinesis 1

domestic cat(101088580) protein regulator of cytokinesis 1

dog(488742) protein regulator of cytokinesis 1

cow(767818) protein regulator of cytokinesis 1

sheep(101103846) protein regulator of cytokinesis 1

naked mole-rat(101713486) protein regulator of cytokinesis 1

Domestic Rabbit(100346153) protein regulator of cytokinesis 1

domestic guinea pig(100728356) protein regulator of cytokinesis 1

Custom Gene Products

Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product #	Description	Species Reactivity	Application	Add to Cart

HPA034521	Anti-PRC1 antibody produced in rabbit Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution	rat, mouse, human	immunohistochemistry, western blot	pricing

WH0009055M1	Monoclonal Anti-PRC1 antibody produced in mouse clone 3E3-1G1, purified immunoglobulin, buffered aqueous solution	human	ELISA, western blot	pricing

SAB1404663	Monoclonal Anti-PRC1 antibody produced in mouse clone 3B10-1F9, purified immunoglobulin, buffered aqueous solution	human	ELISA, immunofluorescence, western blot	pricing

Zinc Finger Nucleases

Product #	Description	Add to Cart

CKOZFN17364	CompoZr^® Knockout ZFN Kit Human PRC1 (NM_003981)	pricing

CKOZFN39247	CompoZr^® Knockout ZFN Kit Mouse Prc1 (NM_145150.2)	pricing

CKOZFN60537	CompoZr^® Knockout ZFN Kit Rat Prc1 (NM_001107529)	pricing

CKOZFND17364	CompoZr^® Knockout ZFN Kit, ZFN plasmid only Human PRC1 (NM_003981)	pricing

CKOZFND39247	CompoZr^® Knockout ZFN Kit, ZFN plasmid only Mouse Prc1 (NM_145150.2)	pricing

CKOZFND60537	CompoZr^® Knockout ZFN Kit, ZFN plasmid only Rat Prc1 (NM_001107529)	pricing

Proteins

Product #	Description	Species	Add to Cart

APREST74670	PrEST Antigen PRC1 Prestige Antigens^™ Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

QPREST21223	SILu^™PrEST PRC1 SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

QPREST21224	SILu^™PrEST PRC1 SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

3'UTR GoClone

Product #	Description	Species	Add to Cart

HUTR08372	MISSION^® 3′UTR Lenti GoClone^™ Powered by SwitchGear Genomics^™, 3′UTR, human, PRC1	human	pricing

shRNA

Type	Description	Species	Add to Cart

SHCLNG-NM_145150	MISSION® shRNA Bacterial Glycerol Stock	mouse	pricing
SHCLND-NM_145150	MISSION® shRNA Plasmid DNA	mouse	pricing
SHCLNV-NM_145150	MISSION® shRNA Lentiviral Transduction Particles	mouse	pricing
SHCLNG-NM_003981	MISSION® shRNA Bacterial Glycerol Stock	human	pricing
SHCLND-NM_003981	MISSION® shRNA Plasmid DNA	human	pricing
SHCLNV-NM_003981	MISSION® shRNA Lentiviral Transduction Particles	human	pricing

esiRNA

Product #	Description	Species	Add to Cart

EHU100971	MISSION^® esiRNA esiRNA human PRC1 (esiRNA1)	human	pricing

Related Products

Product #	Description	Add to Cart

ABT120	Anti-Protein Regulator of Cytokinesis 1 (PRC1) Antibody Anti-Protein Regulator of Cytokinesis 1 (PRC1) Antibody is an antibody against Protein Regulator of Cytokinesis 1 (PRC1) for use in WB & IC.	pricing

SYBR® Green Primers

Product #	Description

KSPQ12012	KiCqStart® SYBR® Green Primers Predesigned primers for gene expression analysis
KSGA2013	KiCqStart® SYBR® Green Primers Gene Arrays for expression analysis of gene families

Custom CRISPR Plasmid

Product #	Description

CRISPR	Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.

Product #	siRNA Type	Species

NM_003981	Rosetta Predictions	human	pricing
NM_199413	Rosetta Predictions	human	pricing
NM_199414	Rosetta Predictions	human	pricing
NM_001107529	Rosetta Predictions	rat	pricing
NM_145150	Rosetta Predictions	mouse	pricing

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_003981	Rosetta Predictions	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs02_00336676 predicted	651
2	SASI_Hs01_00183875 predicted	612
3	SASI_Hs02_00336677 predicted	1109
4	SASI_Hs01_00183876 predicted	1409
5	SASI_Hs01_00183877 predicted	538
6	SASI_Hs01_00183878 predicted	628
7	SASI_Hs01_00183881 predicted	540
8	SASI_Hs01_00183882 predicted	358
9	SASI_Hs01_00183883 predicted	1442
10	SASI_Hs01_00183884 predicted	932
11	SASI_Hs01_00183879 predicted	1135
12	SASI_Hs01_00183880 predicted	399

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_199413	Rosetta Predictions	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs02_00372807 predicted	658
2	SASI_Hs01_00080625 predicted	618
3	SASI_Hs02_00372808 predicted	1113
4	SASI_Hs01_00080626 predicted	1410
5	SASI_Hs01_00080627 predicted	532
6	SASI_Hs01_00080628 predicted	625
7	SASI_Hs01_00080631 predicted	544
8	SASI_Hs01_00080632 predicted	352
9	SASI_Hs01_00080633 predicted	1434
10	SASI_Hs01_00080634 predicted	930
11	SASI_Hs01_00080629 predicted	1139
12	SASI_Hs01_00080630 predicted	399

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_199414	Rosetta Predictions	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs02_00372809 predicted	657
2	SASI_Hs01_00128728 predicted	610
3	SASI_Hs02_00372810 predicted	1111
4	SASI_Hs01_00128729 predicted	1409
5	SASI_Hs01_00128730 predicted	529
6	SASI_Hs01_00128731 predicted	628
7	SASI_Hs01_00128734 predicted	542
8	SASI_Hs01_00128735 predicted	352
9	SASI_Hs01_00128736 predicted	1440
10	SASI_Hs01_00128737 predicted	932
11	SASI_Hs01_00128732 predicted	1136
12	SASI_Hs01_00128733 predicted	401

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_001107529	Rosetta Predictions	Rat

Ranking	siRNA ID	Sequence Start ?
1	SASI_Rn02_00229725 predicted	643
2	SASI_Rn02_00229726 predicted	610
3	SASI_Rn02_00229727 predicted	637
4	SASI_Rn02_00229728 predicted	520
5	SASI_Rn02_00229729 predicted	597
6	SASI_Rn02_00229730 predicted	1076
7	SASI_Rn02_00229731 predicted	753
8	SASI_Rn02_00229732 predicted	1913
9	SASI_Rn02_00229733 predicted	2024
10	SASI_Rn02_00229734 predicted	1944

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_145150	Rosetta Predictions	Mouse

Ranking	siRNA ID	Sequence Start ?
1	SASI_Mm02_00340556 predicted	1423
2	SASI_Mm02_00340557 predicted	898
3	SASI_Mm02_00340558 predicted	252
4	SASI_Mm02_00340559 predicted	637
5	SASI_Mm02_00340560 predicted	647
6	SASI_Mm02_00340561 predicted	1370
7	SASI_Mm02_00340562 predicted	629
8	SASI_Mm02_00340563 predicted	1071
9	SASI_Mm02_00340564 predicted	427
10	SASI_Mm02_00340565 predicted	224

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_145150 VALIDATED	PRC1 MISSION shRNA Bacterial Glycerol Stock protein regulator of cytokinesis 1	Mouse

12 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000217220
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_145150.2-1897s1c1
	Sequence:CCGGCTACGTCTCGAATCCTCAATTCTCGAGAATTGAGGATTCGAGACGTAGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000340488
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.85	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_145150.2-2793s21c1
	Sequence:CCGGCTTTGCACATCTACAAGTTATCTCGAGATAACTTGTAGATGTGCAAAGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000190626
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_145150.1-373s1c1
	Sequence:CCGGGCGCACTCAAGTAGAATTGATCTCGAGATCAATTCTACTTGAGTGCGCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000340564
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.84	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_145150.2-1835s21c1
	Sequence:CCGGGTCTGTTGCCAGCACCTATTCCTCGAGGAATAGGTGCTGGCAACAGACTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000340487
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.63	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_145150.2-171s21c1
	Sequence:CCGGCTAACTCACCTCCGGGAAATACTCGAGTATTTCCCGGAGGTGAGTTAGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000352509
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.89	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_145150.2-2142s21c1
	Sequence:CCGGTGATTCAAGAGAGACCTTAAACTCGAGTTTAAGGTCTCTCTTGAATCATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000340562
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.89	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_145150.2-1120s21c1
	Sequence:CCGGATGCCGAGATTGTACGGTTAACTCGAGTTAACCGTACAATCTCGGCATTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000215814
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.78	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_145150.2-2793s1c1
	Sequence:CCGGCTTTGCACATCTACAAGTTATCTCGAGATAACTTGTAGATGTGCAAAGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000219541
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.87	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_145150.1-2081s1c1
	Sequence:CCGGTGATTCAAGAGAGACCTTAAACTCGAGTTTAAGGTCTCTCTTGAATCATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000219540
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.79	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_145150.1-1068s1c1
	Sequence:CCGGATGCCGAGATTGTACGGTTAACTCGAGTTAACCGTACAATCTCGGCATTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000219539
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_145150.1-836s1c1
	Sequence:CCGGGAGCCTGTGGAGGCAATTATGCTCGAGCATAATTGCCTCCACAGGCTCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000219538
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.78	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_145150.1-119s1c1
	Sequence:CCGGCTAACTCACCTCCGGGAAATACTCGAGTATTTCCCGGAGGTGAGTTAGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_145150 VALIDATED	PRC1 MISSION shRNA shRNA Plasmid DNA protein regulator of cytokinesis 1	Mouse

12 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000217220
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_145150.2-1897s1c1
	Sequence:CCGGCTACGTCTCGAATCCTCAATTCTCGAGAATTGAGGATTCGAGACGTAGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000340488
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.85	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_145150.2-2793s21c1
	Sequence:CCGGCTTTGCACATCTACAAGTTATCTCGAGATAACTTGTAGATGTGCAAAGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000190626
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_145150.1-373s1c1
	Sequence:CCGGGCGCACTCAAGTAGAATTGATCTCGAGATCAATTCTACTTGAGTGCGCTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000340564
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.84	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_145150.2-1835s21c1
	Sequence:CCGGGTCTGTTGCCAGCACCTATTCCTCGAGGAATAGGTGCTGGCAACAGACTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000340487
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.63	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_145150.2-171s21c1
	Sequence:CCGGCTAACTCACCTCCGGGAAATACTCGAGTATTTCCCGGAGGTGAGTTAGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000352509
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.89	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_145150.2-2142s21c1
	Sequence:CCGGTGATTCAAGAGAGACCTTAAACTCGAGTTTAAGGTCTCTCTTGAATCATTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000340562
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.89	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_145150.2-1120s21c1
	Sequence:CCGGATGCCGAGATTGTACGGTTAACTCGAGTTAACCGTACAATCTCGGCATTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000215814
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.78	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_145150.2-2793s1c1
	Sequence:CCGGCTTTGCACATCTACAAGTTATCTCGAGATAACTTGTAGATGTGCAAAGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000219541
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.87	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_145150.1-2081s1c1
	Sequence:CCGGTGATTCAAGAGAGACCTTAAACTCGAGTTTAAGGTCTCTCTTGAATCATTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000219540
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.79	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_145150.1-1068s1c1
	Sequence:CCGGATGCCGAGATTGTACGGTTAACTCGAGTTAACCGTACAATCTCGGCATTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000219539
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_145150.1-836s1c1
	Sequence:CCGGGAGCCTGTGGAGGCAATTATGCTCGAGCATAATTGCCTCCACAGGCTCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000219538
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.78	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_145150.1-119s1c1
	Sequence:CCGGCTAACTCACCTCCGGGAAATACTCGAGTATTTCCCGGAGGTGAGTTAGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_145150 VALIDATED	PRC1 MISSION shRNA Lentiviral Transduction Particles protein regulator of cytokinesis 1	Mouse

12 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000217220
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_145150.2-1897s1c1
	Sequence:CCGGCTACGTCTCGAATCCTCAATTCTCGAGAATTGAGGATTCGAGACGTAGTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000340488
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.85	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_145150.2-2793s21c1
	Sequence:CCGGCTTTGCACATCTACAAGTTATCTCGAGATAACTTGTAGATGTGCAAAGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000190626
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_145150.1-373s1c1
	Sequence:CCGGGCGCACTCAAGTAGAATTGATCTCGAGATCAATTCTACTTGAGTGCGCTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000340564
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.84	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_145150.2-1835s21c1
	Sequence:CCGGGTCTGTTGCCAGCACCTATTCCTCGAGGAATAGGTGCTGGCAACAGACTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000340487
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.63	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_145150.2-171s21c1
	Sequence:CCGGCTAACTCACCTCCGGGAAATACTCGAGTATTTCCCGGAGGTGAGTTAGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000352509
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.89	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_145150.2-2142s21c1
	Sequence:CCGGTGATTCAAGAGAGACCTTAAACTCGAGTTTAAGGTCTCTCTTGAATCATTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000340562
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.89	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_145150.2-1120s21c1
	Sequence:CCGGATGCCGAGATTGTACGGTTAACTCGAGTTAACCGTACAATCTCGGCATTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000215814
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.78	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_145150.2-2793s1c1
	Sequence:CCGGCTTTGCACATCTACAAGTTATCTCGAGATAACTTGTAGATGTGCAAAGTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000219541
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.87	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_145150.1-2081s1c1
	Sequence:CCGGTGATTCAAGAGAGACCTTAAACTCGAGTTTAAGGTCTCTCTTGAATCATTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000219540
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.79	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_145150.1-1068s1c1
	Sequence:CCGGATGCCGAGATTGTACGGTTAACTCGAGTTAACCGTACAATCTCGGCATTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000219539
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_145150.1-836s1c1
	Sequence:CCGGGAGCCTGTGGAGGCAATTATGCTCGAGCATAATTGCCTCCACAGGCTCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000219538
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.78	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_145150.1-119s1c1
	Sequence:CCGGCTAACTCACCTCCGGGAAATACTCGAGTATTTCCCGGAGGTGAGTTAGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_003981 VALIDATED	PRC1 MISSION shRNA Bacterial Glycerol Stock protein regulator of cytokinesis 1	Human

15 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000166004
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_003981.2-2277s1c1
	Sequence:CCGGGCCTGACTTCTCTACCACATACTCGAGTATGTGGTAGAGAAGTCAGGCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000158609
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_003981.2-1400s1c1
	Sequence:CCGGCAGGAACATTCAAAGGCATTTCTCGAGAAATGCCTTTGAATGTTCCTGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000280717
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.96	Cell Line: A549
	TRC Version: 2	Clone ID:NM_003981.2-2507s21c1
	Sequence:CCGGCCTCCTGAAGAGAATGTCTTTCTCGAGAAAGACATTCTCTTCAGGAGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000280793
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.96	Cell Line: A549
	TRC Version: 2	Clone ID:NM_003981.2-1400s21c1
	Sequence:CCGGCAGGAACATTCAAAGGCATTTCTCGAGAAATGCCTTTGAATGTTCCTGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000280792
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_003981.2-2277s21c1
	Sequence:CCGGGCCTGACTTCTCTACCACATACTCGAGTATGTGGTAGAGAAGTCAGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000280716
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.88	Cell Line: A549
	TRC Version: 2	Clone ID:NM_003981.2-399s21c1
	Sequence:CCGGGCGAGTTACATGTTGAGCCATCTCGAGATGGCTCAACATGTAACTCGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000280715
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.98	Cell Line: A549
	TRC Version: 2	Clone ID:NM_003981.2-337s21c1
	Sequence:CCGGCCTGAAGGAAAGACTCATCAACTCGAGTTGATGAGTCTTTCCTTCAGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000158904
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_003981.2-695s1c1
	Sequence:CCGGCAGATCATACTGTGTATGGAACTCGAGTTCCATACACAGTATGATCTGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000159416
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.77	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003981.2-2147s1c1
	Sequence:CCGGGCCTAACTTAAAGATGTGAATCTCGAGATTCACATCTTTAAGTTAGGCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000159775
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.92	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003981.2-2587s1c1
	Sequence:CCGGGCAGCTTTGTTAAATTGTGTTCTCGAGAACACAATTTAACAAAGCTGCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000160679
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.99	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003981.2-337s1c1
	Sequence:CCGGCCTGAAGGAAAGACTCATCAACTCGAGTTGATGAGTCTTTCCTTCAGGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000161833
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.76	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003981.2-1379s1c1
	Sequence:CCGGGCACGAATTGAATTGTGGGAACTCGAGTTCCCACAATTCAATTCGTGCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000162697
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.99	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003981.2-2507s1c1
	Sequence:CCGGCCTCCTGAAGAGAATGTCTTTCTCGAGAAAGACATTCTCTTCAGGAGGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000165078
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.93	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003981.2-977s1c1
	Sequence:CCGGGCGCTGCAATTAGAAGTGGATCTCGAGATCCACTTCTAATTGCAGCGCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000165472
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.9	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003981.2-399s1c1
	Sequence:CCGGGCGAGTTACATGTTGAGCCATCTCGAGATGGCTCAACATGTAACTCGCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_003981 VALIDATED	PRC1 MISSION shRNA shRNA Plasmid DNA protein regulator of cytokinesis 1	Human

15 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000166004
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_003981.2-2277s1c1
	Sequence:CCGGGCCTGACTTCTCTACCACATACTCGAGTATGTGGTAGAGAAGTCAGGCTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000158609
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_003981.2-1400s1c1
	Sequence:CCGGCAGGAACATTCAAAGGCATTTCTCGAGAAATGCCTTTGAATGTTCCTGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000280717
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.96	Cell Line: A549
	TRC Version: 2	Clone ID:NM_003981.2-2507s21c1
	Sequence:CCGGCCTCCTGAAGAGAATGTCTTTCTCGAGAAAGACATTCTCTTCAGGAGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000280793
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.96	Cell Line: A549
	TRC Version: 2	Clone ID:NM_003981.2-1400s21c1
	Sequence:CCGGCAGGAACATTCAAAGGCATTTCTCGAGAAATGCCTTTGAATGTTCCTGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000280792
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_003981.2-2277s21c1
	Sequence:CCGGGCCTGACTTCTCTACCACATACTCGAGTATGTGGTAGAGAAGTCAGGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000280716
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.88	Cell Line: A549
	TRC Version: 2	Clone ID:NM_003981.2-399s21c1
	Sequence:CCGGGCGAGTTACATGTTGAGCCATCTCGAGATGGCTCAACATGTAACTCGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000280715
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.98	Cell Line: A549
	TRC Version: 2	Clone ID:NM_003981.2-337s21c1
	Sequence:CCGGCCTGAAGGAAAGACTCATCAACTCGAGTTGATGAGTCTTTCCTTCAGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000158904
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_003981.2-695s1c1
	Sequence:CCGGCAGATCATACTGTGTATGGAACTCGAGTTCCATACACAGTATGATCTGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000159416
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.77	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003981.2-2147s1c1
	Sequence:CCGGGCCTAACTTAAAGATGTGAATCTCGAGATTCACATCTTTAAGTTAGGCTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000159775
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.92	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003981.2-2587s1c1
	Sequence:CCGGGCAGCTTTGTTAAATTGTGTTCTCGAGAACACAATTTAACAAAGCTGCTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000160679
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.99	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003981.2-337s1c1
	Sequence:CCGGCCTGAAGGAAAGACTCATCAACTCGAGTTGATGAGTCTTTCCTTCAGGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000161833
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.76	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003981.2-1379s1c1
	Sequence:CCGGGCACGAATTGAATTGTGGGAACTCGAGTTCCCACAATTCAATTCGTGCTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000162697
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.99	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003981.2-2507s1c1
	Sequence:CCGGCCTCCTGAAGAGAATGTCTTTCTCGAGAAAGACATTCTCTTCAGGAGGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000165078
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.93	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003981.2-977s1c1
	Sequence:CCGGGCGCTGCAATTAGAAGTGGATCTCGAGATCCACTTCTAATTGCAGCGCTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000165472
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.9	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003981.2-399s1c1
	Sequence:CCGGGCGAGTTACATGTTGAGCCATCTCGAGATGGCTCAACATGTAACTCGCTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_003981 VALIDATED	PRC1 MISSION shRNA Lentiviral Transduction Particles protein regulator of cytokinesis 1	Human

15 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000166004
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_003981.2-2277s1c1
	Sequence:CCGGGCCTGACTTCTCTACCACATACTCGAGTATGTGGTAGAGAAGTCAGGCTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000158609
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_003981.2-1400s1c1
	Sequence:CCGGCAGGAACATTCAAAGGCATTTCTCGAGAAATGCCTTTGAATGTTCCTGTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000280717
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.96	Cell Line: A549
	TRC Version: 2	Clone ID:NM_003981.2-2507s21c1
	Sequence:CCGGCCTCCTGAAGAGAATGTCTTTCTCGAGAAAGACATTCTCTTCAGGAGGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000280793
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.96	Cell Line: A549
	TRC Version: 2	Clone ID:NM_003981.2-1400s21c1
	Sequence:CCGGCAGGAACATTCAAAGGCATTTCTCGAGAAATGCCTTTGAATGTTCCTGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000280792
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_003981.2-2277s21c1
	Sequence:CCGGGCCTGACTTCTCTACCACATACTCGAGTATGTGGTAGAGAAGTCAGGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000280716
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.88	Cell Line: A549
	TRC Version: 2	Clone ID:NM_003981.2-399s21c1
	Sequence:CCGGGCGAGTTACATGTTGAGCCATCTCGAGATGGCTCAACATGTAACTCGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000280715
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.98	Cell Line: A549
	TRC Version: 2	Clone ID:NM_003981.2-337s21c1
	Sequence:CCGGCCTGAAGGAAAGACTCATCAACTCGAGTTGATGAGTCTTTCCTTCAGGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000158904
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_003981.2-695s1c1
	Sequence:CCGGCAGATCATACTGTGTATGGAACTCGAGTTCCATACACAGTATGATCTGTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000159416
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.77	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003981.2-2147s1c1
	Sequence:CCGGGCCTAACTTAAAGATGTGAATCTCGAGATTCACATCTTTAAGTTAGGCTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000159775
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.92	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003981.2-2587s1c1
	Sequence:CCGGGCAGCTTTGTTAAATTGTGTTCTCGAGAACACAATTTAACAAAGCTGCTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000160679
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.99	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003981.2-337s1c1
	Sequence:CCGGCCTGAAGGAAAGACTCATCAACTCGAGTTGATGAGTCTTTCCTTCAGGTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000161833
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.76	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003981.2-1379s1c1
	Sequence:CCGGGCACGAATTGAATTGTGGGAACTCGAGTTCCCACAATTCAATTCGTGCTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000162697
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.99	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003981.2-2507s1c1
	Sequence:CCGGCCTCCTGAAGAGAATGTCTTTCTCGAGAAAGACATTCTCTTCAGGAGGTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000165078
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.93	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003981.2-977s1c1
	Sequence:CCGGGCGCTGCAATTAGAAGTGGATCTCGAGATCCACTTCTAATTGCAGCGCTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000165472
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.9	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003981.2-399s1c1
	Sequence:CCGGGCGAGTTACATGTTGAGCCATCTCGAGATGGCTCAACATGTAACTCGCTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart