EMAIL THIS PAGE TO A FRIEND

PRCD

progressive rod-cone degeneration

14 Gene Product Result for
Synonyms: RP36
UniProtKB ID: Q00LT1, B9EJD4
Gene ID:
Human(768206) Summary: This gene is predominantly expressed in the retina, and mutations in this gene are the cause of autosomal recessive retinal degeneration in both humans and dogs. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2010]
cow(100297029) progressive rod-cone degeneration
sheep(101104327) progressive rod-cone degeneration
naked mole-rat(101714585) progressive rod-cone degeneration
domestic guinea pig(101788669) progressive rod-cone degeneration
domestic cat(101085163) progressive rod-cone degeneration
dog(100049006) progressive rod-cone degeneration
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001077620 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001077620 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001077620 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077620 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077620 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313004 predicted 529
2 SASI_Hs02_00313005 predicted 469
3 SASI_Hs02_00313006 predicted 648
4 SASI_Hs02_00313007 predicted 393
5 SASI_Hs02_00313008 predicted 524
6 SASI_Hs02_00313009 predicted 398
7 SASI_Hs02_00313010 predicted 396
8 SASI_Hs02_00313011 predicted 463
9 SASI_Hs02_00313012 predicted 392
10 SASI_Hs02_00313013 predicted 200
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001077620
PRCD MISSION shRNA Bacterial Glycerol Stock
progressive rod-cone degeneration
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077620.1-207s21c1
Sequence:CCGGCTCTGAAGTAAGCCCTCACCTCTCGAGAGGTGAGGGCTTACTTCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077620.1-193s21c1
Sequence:CCGGCAGGGAGAAAGAACCTCTGAACTCGAGTTCAGAGGTTCTTTCTCCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077620.1-105s21c1
Sequence:CCGGGATTTGCCAACCGAGTCCAACCTCGAGGTTGGACTCGGTTGGCAAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077620.1-182s21c1
Sequence:CCGGCAGTCCTCAGGCAGGGAGAAACTCGAGTTTCTCCCTGCCTGAGGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262319    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001077620.1-729s21c1
Sequence:CCGGCTGATGTCTCACAGCTATTAGCTCGAGCTAATAGCTGTGAGACATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001077620
PRCD MISSION shRNA shRNA Plasmid DNA
progressive rod-cone degeneration
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077620.1-207s21c1
Sequence:CCGGCTCTGAAGTAAGCCCTCACCTCTCGAGAGGTGAGGGCTTACTTCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077620.1-193s21c1
Sequence:CCGGCAGGGAGAAAGAACCTCTGAACTCGAGTTCAGAGGTTCTTTCTCCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077620.1-105s21c1
Sequence:CCGGGATTTGCCAACCGAGTCCAACCTCGAGGTTGGACTCGGTTGGCAAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077620.1-182s21c1
Sequence:CCGGCAGTCCTCAGGCAGGGAGAAACTCGAGTTTCTCCCTGCCTGAGGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262319    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001077620.1-729s21c1
Sequence:CCGGCTGATGTCTCACAGCTATTAGCTCGAGCTAATAGCTGTGAGACATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001077620
PRCD MISSION shRNA Lentiviral Transduction Particles
progressive rod-cone degeneration
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077620.1-207s21c1
Sequence:CCGGCTCTGAAGTAAGCCCTCACCTCTCGAGAGGTGAGGGCTTACTTCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077620.1-193s21c1
Sequence:CCGGCAGGGAGAAAGAACCTCTGAACTCGAGTTCAGAGGTTCTTTCTCCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077620.1-105s21c1
Sequence:CCGGGATTTGCCAACCGAGTCCAACCTCGAGGTTGGACTCGGTTGGCAAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077620.1-182s21c1
Sequence:CCGGCAGTCCTCAGGCAGGGAGAAACTCGAGTTTCTCCCTGCCTGAGGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262319    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001077620.1-729s21c1
Sequence:CCGGCTGATGTCTCACAGCTATTAGCTCGAGCTAATAGCTGTGAGACATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)