EMAIL THIS PAGE TO A FRIEND

PRCP

prolylcarboxypeptidase (angiotensinase C)

132 Gene Product Result for
Synonyms: HUMPCP PCP
UniProtKB ID: P42785, A8MU24, B2R7B7, B3KRK5, B5BU34
Gene ID:
Human(5547) Summary: The protein encoded by this gene is a lysosomal prolylcarboxypeptidase, which cleaves C-terminal amino acids linked to proline in peptides such as angiotension II, III and des-Arg9-bradykinin. The cleavage occurs at acidic pH, but the enzyme activity is retained with some substrates at neutral pH. This enzyme has been shown to be an activator of the cell matrix-associated prekallikrein. The importance of angiotension II, one of the substrates of this enzyme, in regulating blood pressure and electrolyte balance suggests that this gene may be related to essential hypertension. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Mouse(72461) prolylcarboxypeptidase (angiotensinase C)
Rat(293118) prolylcarboxypeptidase (angiotensinase C)
Zebrafish(436967) prolylcarboxypeptidase (angiotensinase C)
chicken(428096) prolylcarboxypeptidase (angiotensinase C)
Horse(100061830) prolylcarboxypeptidase (angiotensinase C)
domestic cat(101100665) prolylcarboxypeptidase (angiotensinase C)
dog(476788) prolylcarboxypeptidase (angiotensinase C)
domestic guinea pig(100734342) prolylcarboxypeptidase (angiotensinase C)
naked mole-rat(101719590) prolylcarboxypeptidase (angiotensinase C)
cow(534927) prolylcarboxypeptidase (angiotensinase C)
sheep(101107644) prolylcarboxypeptidase (angiotensinase C)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1646 Human PRCP ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028243 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028243 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028243 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005040 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005040 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005040 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005040 Rosetta Predictions human pricing
NM_199418 Rosetta Predictions human pricing
NM_001106281 Rosetta Predictions rat pricing
NM_028243 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005040 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206315 predicted 970
2 SASI_Hs01_00206316 predicted 1124
3 SASI_Hs01_00206317 predicted 720
4 SASI_Hs01_00206318 predicted 905
5 SASI_Hs01_00206319 predicted 1190
6 SASI_Hs01_00206320 predicted 728
7 SASI_Hs01_00206321 predicted 894
8 SASI_Hs01_00206322 predicted 1560
9 SASI_Hs01_00206323 predicted 733
10 SASI_Hs02_00338836 predicted 1155
11 SASI_Hs01_00206314 predicted 748
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199418 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018776 predicted 1039
2 SASI_Hs01_00018777 predicted 1191
3 SASI_Hs01_00018778 predicted 784
4 SASI_Hs01_00018779 predicted 965
5 SASI_Hs01_00018780 predicted 1247
6 SASI_Hs01_00018781 predicted 791
7 SASI_Hs01_00018782 predicted 954
8 SASI_Hs01_00018783 predicted 1630
9 SASI_Hs01_00018784 predicted 797
10 SASI_Hs02_00372817 predicted 1219
11 SASI_Hs01_00018775 predicted 812
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106281 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217428 predicted 1209
2 SASI_Rn02_00217429 predicted 857
3 SASI_Rn02_00217430 predicted 1246
4 SASI_Rn02_00217431 predicted 739
5 SASI_Rn02_00217432 predicted 511
6 SASI_Rn02_00217433 predicted 727
7 SASI_Rn02_00217434 predicted 401
8 SASI_Rn02_00217435 predicted 1045
9 SASI_Rn02_00217436 predicted 614
10 SASI_Rn02_00217437 predicted 980
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028243 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032383 predicted 1065
2 SASI_Mm01_00032385 predicted 817
3 SASI_Mm01_00032386 predicted 599
4 SASI_Mm01_00032387 predicted 1190
5 SASI_Mm01_00032388 predicted 941
6 SASI_Mm02_00333587 predicted 1149
7 SASI_Mm01_00032389 predicted 738
8 SASI_Mm01_00032390 predicted 1231
9 SASI_Mm01_00032391 predicted 273
10 SASI_Mm01_00032392 predicted 747
11 SASI_Mm01_00032384 predicted 462
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028243
VALIDATED
PRCP MISSION shRNA Bacterial Glycerol Stock
prolylcarboxypeptidase (angiotensinase C)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000447707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028243.3-1062s21c1
Sequence:CCGGTTCCAAGCTCTGAGTGTATATCTCGAGATATACACTCAGAGCTTGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028243.3-737s21c1
Sequence:CCGGGAAGATTGTAACTAACGATTTCTCGAGAAATCGTTAGTTACAATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028243.3-1881s21c1
Sequence:CCGGAGTCTCTCTGGCCCATTGTAACTCGAGTTACAATGGGCCAGAGAGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000450236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028243.3-1548s21c1
Sequence:CCGGAGCAATATCCAATGAACAATTCTCGAGAATTGTTCATTGGATATTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028243.1-1710s1c1
Sequence:CCGGGCCTCACTGTCTTTGTGTCATCTCGAGATGACACAAAGACAGTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028243.1-170s1c1
Sequence:CCGGGCCCGTAAATACTCAGTTCTTCTCGAGAAGAACTGAGTATTTACGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028243.1-810s1c1
Sequence:CCGGCGAACATTCTTCACCTATGTACTCGAGTACATAGGTGAAGAATGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028243.1-171s1c1
Sequence:CCGGCCCGTAAATACTCAGTTCTTTCTCGAGAAAGAACTGAGTATTTACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028243.1-274s1c1
Sequence:CCGGGCAGAGAAATGGTGGATCAATCTCGAGATTGATCCACCATTTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028243
VALIDATED
PRCP MISSION shRNA shRNA Plasmid DNA
prolylcarboxypeptidase (angiotensinase C)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000447707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028243.3-1062s21c1
Sequence:CCGGTTCCAAGCTCTGAGTGTATATCTCGAGATATACACTCAGAGCTTGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028243.3-737s21c1
Sequence:CCGGGAAGATTGTAACTAACGATTTCTCGAGAAATCGTTAGTTACAATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000442576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028243.3-1881s21c1
Sequence:CCGGAGTCTCTCTGGCCCATTGTAACTCGAGTTACAATGGGCCAGAGAGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000450236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028243.3-1548s21c1
Sequence:CCGGAGCAATATCCAATGAACAATTCTCGAGAATTGTTCATTGGATATTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028243.1-1710s1c1
Sequence:CCGGGCCTCACTGTCTTTGTGTCATCTCGAGATGACACAAAGACAGTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028243.1-170s1c1
Sequence:CCGGGCCCGTAAATACTCAGTTCTTCTCGAGAAGAACTGAGTATTTACGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028243.1-810s1c1
Sequence:CCGGCGAACATTCTTCACCTATGTACTCGAGTACATAGGTGAAGAATGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028243.1-171s1c1
Sequence:CCGGCCCGTAAATACTCAGTTCTTTCTCGAGAAAGAACTGAGTATTTACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028243.1-274s1c1
Sequence:CCGGGCAGAGAAATGGTGGATCAATCTCGAGATTGATCCACCATTTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028243
VALIDATED
PRCP MISSION shRNA Lentiviral Transduction Particles
prolylcarboxypeptidase (angiotensinase C)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000447707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028243.3-1062s21c1
Sequence:CCGGTTCCAAGCTCTGAGTGTATATCTCGAGATATACACTCAGAGCTTGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028243.3-737s21c1
Sequence:CCGGGAAGATTGTAACTAACGATTTCTCGAGAAATCGTTAGTTACAATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028243.3-1881s21c1
Sequence:CCGGAGTCTCTCTGGCCCATTGTAACTCGAGTTACAATGGGCCAGAGAGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000450236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028243.3-1548s21c1
Sequence:CCGGAGCAATATCCAATGAACAATTCTCGAGAATTGTTCATTGGATATTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028243.1-1710s1c1
Sequence:CCGGGCCTCACTGTCTTTGTGTCATCTCGAGATGACACAAAGACAGTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028243.1-170s1c1
Sequence:CCGGGCCCGTAAATACTCAGTTCTTCTCGAGAAGAACTGAGTATTTACGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028243.1-810s1c1
Sequence:CCGGCGAACATTCTTCACCTATGTACTCGAGTACATAGGTGAAGAATGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028243.1-171s1c1
Sequence:CCGGCCCGTAAATACTCAGTTCTTTCTCGAGAAAGAACTGAGTATTTACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028243.1-274s1c1
Sequence:CCGGGCAGAGAAATGGTGGATCAATCTCGAGATTGATCCACCATTTCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005040
VALIDATED
PRCP MISSION shRNA Bacterial Glycerol Stock
prolylcarboxypeptidase (angiotensinase C)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000301030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005040.2-1534s21c1
Sequence:CCGGGCTCCTTGGAAGTTAGACATACTCGAGTATGTCTAACTTCCAAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323311    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005040.2-1840s21c1
Sequence:CCGGCACCATCAGTGGCCCTCATAACTCGAGTTATGAGGGCCACTGATGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005040.2-747s21c1
Sequence:CCGGTTAGTACCTTGTGGTGTATTTCTCGAGAAATACACCACAAGGTACTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005040.2-324s21c1
Sequence:CCGGCGGTACCTAGTAGCTGATAAACTCGAGTTTATCAGCTACTAGGTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005040.2-1129s1c1
Sequence:CCGGGCCAGGTGAAATGCCTGAATACTCGAGTATTCAGGCATTTCACCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005040.2-908s1c1
Sequence:CCGGCCCATTAACTTCTCAGGACATCTCGAGATGTCCTGAGAAGTTAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005040.2-324s1c1
Sequence:CCGGCGGTACCTAGTAGCTGATAAACTCGAGTTTATCAGCTACTAGGTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005040.2-1534s1c1
Sequence:CCGGGCTCCTTGGAAGTTAGACATACTCGAGTATGTCTAACTTCCAAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005040
VALIDATED
PRCP MISSION shRNA shRNA Plasmid DNA
prolylcarboxypeptidase (angiotensinase C)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000301030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005040.2-1534s21c1
Sequence:CCGGGCTCCTTGGAAGTTAGACATACTCGAGTATGTCTAACTTCCAAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323311    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005040.2-1840s21c1
Sequence:CCGGCACCATCAGTGGCCCTCATAACTCGAGTTATGAGGGCCACTGATGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005040.2-747s21c1
Sequence:CCGGTTAGTACCTTGTGGTGTATTTCTCGAGAAATACACCACAAGGTACTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005040.2-324s21c1
Sequence:CCGGCGGTACCTAGTAGCTGATAAACTCGAGTTTATCAGCTACTAGGTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005040.2-1129s1c1
Sequence:CCGGGCCAGGTGAAATGCCTGAATACTCGAGTATTCAGGCATTTCACCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005040.2-908s1c1
Sequence:CCGGCCCATTAACTTCTCAGGACATCTCGAGATGTCCTGAGAAGTTAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005040.2-324s1c1
Sequence:CCGGCGGTACCTAGTAGCTGATAAACTCGAGTTTATCAGCTACTAGGTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005040.2-1534s1c1
Sequence:CCGGGCTCCTTGGAAGTTAGACATACTCGAGTATGTCTAACTTCCAAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005040
VALIDATED
PRCP MISSION shRNA Lentiviral Transduction Particles
prolylcarboxypeptidase (angiotensinase C)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000301030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005040.2-1534s21c1
Sequence:CCGGGCTCCTTGGAAGTTAGACATACTCGAGTATGTCTAACTTCCAAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323311    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005040.2-1840s21c1
Sequence:CCGGCACCATCAGTGGCCCTCATAACTCGAGTTATGAGGGCCACTGATGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005040.2-747s21c1
Sequence:CCGGTTAGTACCTTGTGGTGTATTTCTCGAGAAATACACCACAAGGTACTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005040.2-324s21c1
Sequence:CCGGCGGTACCTAGTAGCTGATAAACTCGAGTTTATCAGCTACTAGGTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005040.2-1129s1c1
Sequence:CCGGGCCAGGTGAAATGCCTGAATACTCGAGTATTCAGGCATTTCACCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005040.2-908s1c1
Sequence:CCGGCCCATTAACTTCTCAGGACATCTCGAGATGTCCTGAGAAGTTAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005040.2-324s1c1
Sequence:CCGGCGGTACCTAGTAGCTGATAAACTCGAGTTTATCAGCTACTAGGTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005040.2-1534s1c1
Sequence:CCGGGCTCCTTGGAAGTTAGACATACTCGAGTATGTCTAACTTCCAAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)