EMAIL THIS PAGE TO A FRIEND

PRDM10

PR domain containing 10

241 Gene Product Result for
Synonyms: PFM7
Gene ID:
Human(56980) Summary: The protein encoded by this gene is a transcription factor that contains C2H2-type zinc-fingers. It also contains a positive regulatory domain, which has been found in several other zinc-finger transcription factors including those involved in B cell differentiation and tumor suppression. Studies of the mouse counterpart suggest that this protein may be involved in the development of the central nerve system (CNS), as well as in the pathogenesis of neuronal storage disease. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Mouse(382066) PR domain containing 10
Rat(500964) PR domain containing 10
Domestic Rabbit(100356262) PR domain containing 10
naked mole-rat(101696465) PR domain containing 10
domestic guinea pig(100714312) PR domain containing 10
cow(507760) PR domain containing 10
sheep(101119085) PR domain containing 10
Zebrafish(567760) PR domain containing 10
Zebrafish(798383) PR domain zinc finger protein 10
Horse(100064686) PR domain containing 10
domestic cat(101092709) PR domain containing 10
dog(489279) PR domain containing 10
chicken(419729) PR domain containing 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080817 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001080817 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001080817 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020228 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020228 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020228 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020228 Rosetta Predictions human pricing
NM_199437 Rosetta Predictions human pricing
NM_199438 Rosetta Predictions human pricing
NM_199439 Rosetta Predictions human pricing
XM_001056255 Rosetta Predictions rat pricing
XM_576373 Rosetta Predictions rat pricing
NM_001080817 Rosetta Predictions mouse pricing
XM_984485 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020228 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180015 predicted 1372
2 SASI_Hs01_00180017 predicted 739
3 SASI_Hs01_00180019 predicted 1039
4 SASI_Hs01_00180020 predicted 1465
5 SASI_Hs01_00180021 predicted 1983
6 SASI_Hs01_00180023 predicted 1303
7 SASI_Hs01_00180024 predicted 2040
8 SASI_Hs02_00353175 predicted 2479
9 SASI_Hs02_00353176 predicted 2506
10 SASI_Hs02_00353177 predicted 2446
11 SASI_Hs01_00180016 predicted 971
12 SASI_Hs01_00180018 predicted 2557
13 SASI_Hs01_00180022 predicted 3699
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199437 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148375 predicted 1365
2 SASI_Hs01_00148377 predicted 738
3 SASI_Hs01_00148379 predicted 1032
4 SASI_Hs01_00148380 predicted 1467
5 SASI_Hs01_00148381 predicted 1964
6 SASI_Hs01_00148383 predicted 1304
7 SASI_Hs01_00148384 predicted 2023
8 SASI_Hs02_00372831 predicted 2470
9 SASI_Hs02_00372832 predicted 2497
10 SASI_Hs02_00372833 predicted 2440
11 SASI_Hs01_00148376 predicted 964
12 SASI_Hs01_00148378 predicted 2540
13 SASI_Hs01_00148382 predicted 3685
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199438 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211648 predicted 1096
2 SASI_Hs01_00211650 predicted 468
3 SASI_Hs01_00211652 predicted 763
4 SASI_Hs01_00211653 predicted 1190
5 SASI_Hs01_00211654 predicted 1703
6 SASI_Hs01_00211656 predicted 1023
7 SASI_Hs01_00211657 predicted 1770
8 SASI_Hs02_00372834 predicted 2207
9 SASI_Hs02_00372835 predicted 2227
10 SASI_Hs02_00372836 predicted 2173
11 SASI_Hs01_00211649 predicted 698
12 SASI_Hs01_00211651 predicted 2275
13 SASI_Hs01_00211655 predicted 3387
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199439 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056903 predicted 1089
2 SASI_Hs01_00056905 predicted 468
3 SASI_Hs01_00056907 predicted 761
4 SASI_Hs01_00056908 predicted 1188
5 SASI_Hs01_00056909 predicted 1698
6 SASI_Hs01_00056911 predicted 1029
7 SASI_Hs01_00056912 predicted 1758
8 SASI_Hs02_00372837 predicted 2196
9 SASI_Hs02_00372838 predicted 2221
10 SASI_Hs02_00372839 predicted 2165
11 SASI_Hs01_00056904 predicted 692
12 SASI_Hs01_00056906 predicted 2272
13 SASI_Hs01_00056910 predicted 3270
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056255 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00282685 predicted 2901
2 SASI_Rn02_00282686 predicted 665
3 SASI_Rn02_00282687 predicted 2891
4 SASI_Rn02_00282688 predicted 972
5 SASI_Rn02_00282689 predicted 2658
6 SASI_Rn02_00282690 predicted 1795
7 SASI_Rn02_00282691 predicted 2195
8 SASI_Rn02_00282692 predicted 2550
9 SASI_Rn02_00282693 predicted 1115
10 SASI_Rn02_00282694 predicted 3132
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576373 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00405171 predicted 668
2 SASI_Rn02_00405172 predicted 353
3 SASI_Rn02_00405173 predicted 978
4 SASI_Rn02_00405174 predicted 1015
5 SASI_Rn02_00405175 predicted 980
6 SASI_Rn02_00405176 predicted 262
7 SASI_Rn02_00405177 predicted 1595
8 SASI_Rn02_00405178 predicted 1298
9 SASI_Rn02_00405179 predicted 326
10 SASI_Rn02_00405180 predicted 1114
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080817 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293903 predicted 648
2 SASI_Mm02_00293904 predicted 267
3 SASI_Mm02_00293905 predicted 1566
4 SASI_Mm02_00293906 predicted 2132
5 SASI_Mm02_00293907 predicted 2137
6 SASI_Mm02_00293908 predicted 3002
7 SASI_Mm02_00293909 predicted 2120
8 SASI_Mm02_00293910 predicted 3163
9 SASI_Mm02_00293911 predicted 1171
10 SASI_Mm02_00293912 predicted 2438
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_984485 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00225645 predicted 598
2 SASI_Mm01_00225646 predicted 646
3 SASI_Mm01_00225647 predicted 1577
4 SASI_Mm01_00225648 predicted 2049
5 SASI_Mm01_00225649 predicted 2133
6 SASI_Mm01_00225650 predicted 641
7 SASI_Mm01_00225651 predicted 3000
8 SASI_Mm01_00225652 predicted 2126
9 SASI_Mm01_00225653 predicted 3165
10 SASI_Mm01_00225654 predicted 759
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080817
PRDM10 MISSION shRNA Bacterial Glycerol Stock
PR domain containing 10
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080817.1-818s21c1
Sequence:CCGGCCTACGCTGAGTTCGTGAATCCTCGAGGATTCACGAACTCAGCGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080817.1-2205s21c1
Sequence:CCGGCATTGCTTTCATGGTCAAATACTCGAGTATTTGACCATGAAAGCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080817.1-968s21c1
Sequence:GTACCGGATGAGAAACTGGACGTGTTTACTCGAGTAAACACGTCCAGTTTCTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080817.1-2102s21c1
Sequence:CCGGAGTTGACCCTGCCCATCATAACTCGAGTTATGATGGGCAGGGTCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080817.1-909s21c1
Sequence:CCGGTGAGTGCAATCGGCGGTTTATCTCGAGATAAACCGCCGATTGCACTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080817.1-3192s21c1
Sequence:CCGGAGCAGTGACTCCGGGTCATTACTCGAGTAATGACCCGGAGTCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080817
PRDM10 MISSION shRNA shRNA Plasmid DNA
PR domain containing 10
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080817.1-818s21c1
Sequence:CCGGCCTACGCTGAGTTCGTGAATCCTCGAGGATTCACGAACTCAGCGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080817.1-2205s21c1
Sequence:CCGGCATTGCTTTCATGGTCAAATACTCGAGTATTTGACCATGAAAGCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080817.1-968s21c1
Sequence:GTACCGGATGAGAAACTGGACGTGTTTACTCGAGTAAACACGTCCAGTTTCTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080817.1-2102s21c1
Sequence:CCGGAGTTGACCCTGCCCATCATAACTCGAGTTATGATGGGCAGGGTCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080817.1-909s21c1
Sequence:CCGGTGAGTGCAATCGGCGGTTTATCTCGAGATAAACCGCCGATTGCACTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080817.1-3192s21c1
Sequence:CCGGAGCAGTGACTCCGGGTCATTACTCGAGTAATGACCCGGAGTCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080817
PRDM10 MISSION shRNA Lentiviral Transduction Particles
PR domain containing 10
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080817.1-818s21c1
Sequence:CCGGCCTACGCTGAGTTCGTGAATCCTCGAGGATTCACGAACTCAGCGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080817.1-2205s21c1
Sequence:CCGGCATTGCTTTCATGGTCAAATACTCGAGTATTTGACCATGAAAGCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080817.1-968s21c1
Sequence:GTACCGGATGAGAAACTGGACGTGTTTACTCGAGTAAACACGTCCAGTTTCTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080817.1-2102s21c1
Sequence:CCGGAGTTGACCCTGCCCATCATAACTCGAGTTATGATGGGCAGGGTCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080817.1-909s21c1
Sequence:CCGGTGAGTGCAATCGGCGGTTTATCTCGAGATAAACCGCCGATTGCACTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080817.1-3192s21c1
Sequence:CCGGAGCAGTGACTCCGGGTCATTACTCGAGTAATGACCCGGAGTCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020228
PRDM10 MISSION shRNA Bacterial Glycerol Stock
PR domain containing 10
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020228.2-2511s21c1
Sequence:CCGGAGTTAACTCTACCCATCATAACTCGAGTTATGATGGGTAGAGTTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020228.2-4593s21c1
Sequence:CCGGCTGCCTTGCAGGATCCATTTACTCGAGTAAATGGATCCTGCAAGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020228.2-3499s21c1
Sequence:CCGGGGCGGTTACTTCGGGTCATTACTCGAGTAATGACCCGAAGTAACCGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020228.2-1306s21c1
Sequence:CCGGTGAATGTAACCGCCGATTTATCTCGAGATAAATCGGCGGTTACATTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020228.2-1338s21c1
Sequence:GTACCGGAGTTGCAACAGCATCTCAATTCTCGAGAATTGAGATGCTGTTGCAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020228.2-3398s1c1
Sequence:CCGGCGTGGCTATTCATCTGAGATTCTCGAGAATCTCAGATGAATAGCCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020228.2-332s1c1
Sequence:CCGGGCTCAGATTGTCTATACCGATCTCGAGATCGGTATAGACAATCTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020228
PRDM10 MISSION shRNA shRNA Plasmid DNA
PR domain containing 10
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020228.2-2511s21c1
Sequence:CCGGAGTTAACTCTACCCATCATAACTCGAGTTATGATGGGTAGAGTTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020228.2-4593s21c1
Sequence:CCGGCTGCCTTGCAGGATCCATTTACTCGAGTAAATGGATCCTGCAAGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020228.2-3499s21c1
Sequence:CCGGGGCGGTTACTTCGGGTCATTACTCGAGTAATGACCCGAAGTAACCGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020228.2-1306s21c1
Sequence:CCGGTGAATGTAACCGCCGATTTATCTCGAGATAAATCGGCGGTTACATTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020228.2-1338s21c1
Sequence:GTACCGGAGTTGCAACAGCATCTCAATTCTCGAGAATTGAGATGCTGTTGCAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020228.2-3398s1c1
Sequence:CCGGCGTGGCTATTCATCTGAGATTCTCGAGAATCTCAGATGAATAGCCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020228.2-332s1c1
Sequence:CCGGGCTCAGATTGTCTATACCGATCTCGAGATCGGTATAGACAATCTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020228
PRDM10 MISSION shRNA Lentiviral Transduction Particles
PR domain containing 10
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020228.2-2511s21c1
Sequence:CCGGAGTTAACTCTACCCATCATAACTCGAGTTATGATGGGTAGAGTTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020228.2-4593s21c1
Sequence:CCGGCTGCCTTGCAGGATCCATTTACTCGAGTAAATGGATCCTGCAAGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020228.2-3499s21c1
Sequence:CCGGGGCGGTTACTTCGGGTCATTACTCGAGTAATGACCCGAAGTAACCGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020228.2-1306s21c1
Sequence:CCGGTGAATGTAACCGCCGATTTATCTCGAGATAAATCGGCGGTTACATTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020228.2-1338s21c1
Sequence:GTACCGGAGTTGCAACAGCATCTCAATTCTCGAGAATTGAGATGCTGTTGCAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020228.2-3398s1c1
Sequence:CCGGCGTGGCTATTCATCTGAGATTCTCGAGAATCTCAGATGAATAGCCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020228.2-332s1c1
Sequence:CCGGGCTCAGATTGTCTATACCGATCTCGAGATCGGTATAGACAATCTGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)