EMAIL THIS PAGE TO A FRIEND

PRDM11

PR domain containing 11

43 Gene Product Result for
Synonyms: PFM8
UniProtKB ID: Q9NQV5, Q8N9F1
Gene ID:
Mouse(100042784) PR domain containing 11
Rat(690358) PR domain containing 11
Zebrafish(565473) PR domain containing 11
domestic cat(101085069) PR domain containing 11
chicken(423174) PR domain containing 11
cow(524928) PR domain containing 11
sheep(101111903) PR domain containing 11
domestic guinea pig(100723519) PR domain containing 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020229 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020229 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020229 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020229 Rosetta Predictions human pricing
XM_001074223 Rosetta Predictions rat pricing
XM_001478808 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020229 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039635 predicted 1712
2 SASI_Hs01_00039636 predicted 1582
3 SASI_Hs01_00039639 predicted 1722
4 SASI_Hs02_00353178 predicted 1717
5 SASI_Hs01_00039640 predicted 1474
6 SASI_Hs01_00039642 predicted 1498
7 SASI_Hs01_00039644 predicted 1187
8 SASI_Hs02_00353179 predicted 595
9 SASI_Hs02_00353180 predicted 1259
10 SASI_Hs02_00353181 predicted 1622
11 SASI_Hs01_00039637 predicted 789
12 SASI_Hs01_00039638 predicted 1635
13 SASI_Hs01_00039641 predicted 1623
14 SASI_Hs01_00039643 predicted 1783
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074223 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00345453 predicted 564
2 SASI_Rn02_00345454 predicted 531
3 SASI_Rn02_00345455 predicted 566
4 SASI_Rn02_00345456 predicted 572
5 SASI_Rn02_00345457 predicted 568
6 SASI_Rn02_00345458 predicted 541
7 SASI_Rn02_00345459 predicted 437
8 SASI_Rn02_00345460 predicted 405
9 SASI_Rn02_00345461 predicted 425
10 SASI_Rn02_00345462 predicted 538
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001478808 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00405498 predicted 2875
2 SASI_Mm02_00405499 predicted 2762
3 SASI_Mm02_00405500 predicted 2894
4 SASI_Mm02_00405501 predicted 2175
5 SASI_Mm02_00405502 predicted 1827
6 SASI_Mm02_00405503 predicted 2854
7 SASI_Mm02_00405504 predicted 2446
8 SASI_Mm02_00405505 predicted 2555
9 SASI_Mm02_00405506 predicted 2400
10 SASI_Mm02_00405507 predicted 2960
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020229
PRDM11 MISSION shRNA Bacterial Glycerol Stock
PR domain containing 11
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020229.2-738s1c1
Sequence:CCGGGCGATGTGTAAACGAGGTCATCTCGAGATGACCTCGTTTACACATCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020229.2-1584s1c1
Sequence:CCGGCCCTAACTGTATTCGCCTAAACTCGAGTTTAGGCGAATACAGTTAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020229.2-1716s1c1
Sequence:CCGGTGCAGGTAAGTTGGTTTGGATCTCGAGATCCAAACCAACTTACCTGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020229.2-357s1c1
Sequence:CCGGCGAGAACATGAAGGAGTGCTTCTCGAGAAGCACTCCTTCATGTTCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020229.2-841s1c1
Sequence:CCGGGTGGACAAGAACAACCGCTATCTCGAGATAGCGGTTGTTCTTGTCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020229.2-1930s21c1
Sequence:CCGGTGTATCCTCCTTGTCAATAAACTCGAGTTTATTGACAAGGAGGATACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020229.2-1400s21c1
Sequence:CCGGCCCATGGTGTGCAGAATATAGCTCGAGCTATATTCTGCACACCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020229.2-844s21c1
Sequence:CCGGGACAAGAACAACCGCTATAAGCTCGAGCTTATAGCGGTTGTTCTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020229.2-1585s21c1
Sequence:CCGGCCTAACTGTATTCGCCTAAAGCTCGAGCTTTAGGCGAATACAGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020229
PRDM11 MISSION shRNA shRNA Plasmid DNA
PR domain containing 11
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020229.2-738s1c1
Sequence:CCGGGCGATGTGTAAACGAGGTCATCTCGAGATGACCTCGTTTACACATCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020229.2-1584s1c1
Sequence:CCGGCCCTAACTGTATTCGCCTAAACTCGAGTTTAGGCGAATACAGTTAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020229.2-1716s1c1
Sequence:CCGGTGCAGGTAAGTTGGTTTGGATCTCGAGATCCAAACCAACTTACCTGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020229.2-357s1c1
Sequence:CCGGCGAGAACATGAAGGAGTGCTTCTCGAGAAGCACTCCTTCATGTTCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020229.2-841s1c1
Sequence:CCGGGTGGACAAGAACAACCGCTATCTCGAGATAGCGGTTGTTCTTGTCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020229.2-1930s21c1
Sequence:CCGGTGTATCCTCCTTGTCAATAAACTCGAGTTTATTGACAAGGAGGATACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020229.2-1400s21c1
Sequence:CCGGCCCATGGTGTGCAGAATATAGCTCGAGCTATATTCTGCACACCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020229.2-844s21c1
Sequence:CCGGGACAAGAACAACCGCTATAAGCTCGAGCTTATAGCGGTTGTTCTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020229.2-1585s21c1
Sequence:CCGGCCTAACTGTATTCGCCTAAAGCTCGAGCTTTAGGCGAATACAGTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020229
PRDM11 MISSION shRNA Lentiviral Transduction Particles
PR domain containing 11
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020229.2-738s1c1
Sequence:CCGGGCGATGTGTAAACGAGGTCATCTCGAGATGACCTCGTTTACACATCGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000016889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020229.2-1584s1c1
Sequence:CCGGCCCTAACTGTATTCGCCTAAACTCGAGTTTAGGCGAATACAGTTAGGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000016892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020229.2-1716s1c1
Sequence:CCGGTGCAGGTAAGTTGGTTTGGATCTCGAGATCCAAACCAACTTACCTGCATTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000016891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020229.2-357s1c1
Sequence:CCGGCGAGAACATGAAGGAGTGCTTCTCGAGAAGCACTCCTTCATGTTCTCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000016890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020229.2-841s1c1
Sequence:CCGGGTGGACAAGAACAACCGCTATCTCGAGATAGCGGTTGTTCTTGTCCACTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000358535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020229.2-1930s21c1
Sequence:CCGGTGTATCCTCCTTGTCAATAAACTCGAGTTTATTGACAAGGAGGATACATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000367873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020229.2-1400s21c1
Sequence:CCGGCCCATGGTGTGCAGAATATAGCTCGAGCTATATTCTGCACACCATGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000358536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020229.2-844s21c1
Sequence:CCGGGACAAGAACAACCGCTATAAGCTCGAGCTTATAGCGGTTGTTCTTGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000358534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020229.2-1585s21c1
Sequence:CCGGCCTAACTGTATTCGCCTAAAGCTCGAGCTTTAGGCGAATACAGTTAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???