EMAIL THIS PAGE TO A FRIEND

PRDM12

PR domain containing 12

79 Gene Product Result for
Synonyms: PFM9
UniProtKB ID: Q9H4Q4, A3KFK9
Gene ID:
Mouse(381359) PR domain containing 12
Rat(688699) PR domain containing 12
domestic guinea pig(100731018) PR domain containing 12
naked mole-rat(101725660) PR domain containing 12
cow(618320) PR domain containing 12
sheep(101123201) PR domain containing 12
chicken(417183) PR domain containing 12
dog(608616) PR domain containing 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021619 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021619 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021619 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001123362 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001123362 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001123362 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021619 Rosetta Predictions human pricing
XM_001067974 Rosetta Predictions rat pricing
NM_001123362 Rosetta Predictions mouse pricing
XM_355325 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021619 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188921 predicted 1566
2 SASI_Hs01_00188922 predicted 437
3 SASI_Hs01_00188923 predicted 360
4 SASI_Hs01_00188924 predicted 802
5 SASI_Hs01_00188925 predicted 705
6 SASI_Hs01_00188926 predicted 623
7 SASI_Hs01_00188927 predicted 814
8 SASI_Hs02_00354952 predicted 266
9 SASI_Hs01_00188928 predicted 373
10 SASI_Hs01_00188929 predicted 545
11 SASI_Hs01_00188920 predicted 538
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067974 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00323006 predicted 204
2 SASI_Rn02_00323007 predicted 583
3 SASI_Rn02_00323008 predicted 660
4 SASI_Rn02_00323009 predicted 247
5 SASI_Rn02_00323010 predicted 863
6 SASI_Rn02_00323011 predicted 881
7 SASI_Rn02_00323012 predicted 375
8 SASI_Rn02_00323013 predicted 517
9 SASI_Rn02_00323014 predicted 651
10 SASI_Rn02_00323015 predicted 325
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001123362 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309809 predicted 1564
2 SASI_Mm02_00309810 predicted 354
3 SASI_Mm02_00309811 predicted 1610
4 SASI_Mm02_00309812 predicted 807
5 SASI_Mm02_00309813 predicted 823
6 SASI_Mm02_00309814 predicted 563
7 SASI_Mm02_00309815 predicted 473
8 SASI_Mm02_00309816 predicted 541
9 SASI_Mm02_00309817 predicted 1578
10 SASI_Mm02_00309818 predicted 460
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355325 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00230261 predicted 850
2 SASI_Mm01_00230262 predicted 849
3 SASI_Mm01_00230263 predicted 1134
4 SASI_Mm01_00230264 predicted 1139
5 SASI_Mm01_00230265 predicted 879
6 SASI_Mm01_00230266 predicted 862
7 SASI_Mm01_00230267 predicted 916
8 SASI_Mm01_00230268 predicted 1133
9 SASI_Mm01_00230269 predicted 876
10 SASI_Mm01_00230270 predicted 1068
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021619
PRDM12 MISSION shRNA Bacterial Glycerol Stock
PR domain containing 12
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021619.2-367s21c1
Sequence:CCGGTTCTCCAAGACGTGGATCAAGCTCGAGCTTGATCCACGTCTTGGAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021619.2-1569s21c1
Sequence:CCGGAGAGTCCTGTGCTTCGGAATGCTCGAGCATTCCGAAGCACAGGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021619.2-547s21c1
Sequence:CCGGTACATCAAGTGTGCACGTAACCTCGAGGTTACGTGCACACTTGATGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021619.2-464s21c1
Sequence:CCGGTCATGTGGGAGGTGTTCAATGCTCGAGCATTGAACACCTCCCACATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021619.2-366s1c1
Sequence:CCGGCTTCTCCAAGACGTGGATCAACTCGAGTTGATCCACGTCTTGGAGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021619.2-607s1c1
Sequence:CCGGAGCATCTTCTACAAGGCCATTCTCGAGAATGGCCTTGTAGAAGATGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021619.2-438s1c1
Sequence:CCGGCGTGGACATCTGCAAGAACAACTCGAGTTGTTCTTGCAGATGTCCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021619.2-135s1c1
Sequence:CCGGCGAGGTTATCACCTCCGACATCTCGAGATGTCGGAGGTGATAACCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021619.2-534s1c1
Sequence:CCGGGAGCTGGATGACCTACATCAACTCGAGTTGATGTAGGTCATCCAGCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021619
PRDM12 MISSION shRNA shRNA Plasmid DNA
PR domain containing 12
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021619.2-367s21c1
Sequence:CCGGTTCTCCAAGACGTGGATCAAGCTCGAGCTTGATCCACGTCTTGGAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021619.2-1569s21c1
Sequence:CCGGAGAGTCCTGTGCTTCGGAATGCTCGAGCATTCCGAAGCACAGGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021619.2-547s21c1
Sequence:CCGGTACATCAAGTGTGCACGTAACCTCGAGGTTACGTGCACACTTGATGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021619.2-464s21c1
Sequence:CCGGTCATGTGGGAGGTGTTCAATGCTCGAGCATTGAACACCTCCCACATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021619.2-366s1c1
Sequence:CCGGCTTCTCCAAGACGTGGATCAACTCGAGTTGATCCACGTCTTGGAGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021619.2-607s1c1
Sequence:CCGGAGCATCTTCTACAAGGCCATTCTCGAGAATGGCCTTGTAGAAGATGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021619.2-438s1c1
Sequence:CCGGCGTGGACATCTGCAAGAACAACTCGAGTTGTTCTTGCAGATGTCCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021619.2-135s1c1
Sequence:CCGGCGAGGTTATCACCTCCGACATCTCGAGATGTCGGAGGTGATAACCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021619.2-534s1c1
Sequence:CCGGGAGCTGGATGACCTACATCAACTCGAGTTGATGTAGGTCATCCAGCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021619
PRDM12 MISSION shRNA Lentiviral Transduction Particles
PR domain containing 12
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021619.2-367s21c1
Sequence:CCGGTTCTCCAAGACGTGGATCAAGCTCGAGCTTGATCCACGTCTTGGAGAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000358491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021619.2-1569s21c1
Sequence:CCGGAGAGTCCTGTGCTTCGGAATGCTCGAGCATTCCGAAGCACAGGACTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000378327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021619.2-547s21c1
Sequence:CCGGTACATCAAGTGTGCACGTAACCTCGAGGTTACGTGCACACTTGATGTATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000378330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021619.2-464s21c1
Sequence:CCGGTCATGTGGGAGGTGTTCAATGCTCGAGCATTGAACACCTCCCACATGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000017951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021619.2-366s1c1
Sequence:CCGGCTTCTCCAAGACGTGGATCAACTCGAGTTGATCCACGTCTTGGAGAAGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000017949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021619.2-607s1c1
Sequence:CCGGAGCATCTTCTACAAGGCCATTCTCGAGAATGGCCTTGTAGAAGATGCTTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000017948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021619.2-438s1c1
Sequence:CCGGCGTGGACATCTGCAAGAACAACTCGAGTTGTTCTTGCAGATGTCCACGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000017950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021619.2-135s1c1
Sequence:CCGGCGAGGTTATCACCTCCGACATCTCGAGATGTCGGAGGTGATAACCTCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000017952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021619.2-534s1c1
Sequence:CCGGGAGCTGGATGACCTACATCAACTCGAGTTGATGTAGGTCATCCAGCTCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001123362
PRDM12 MISSION shRNA Bacterial Glycerol Stock
PR domain containing 12
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123362.1-312s21c1
Sequence:CCGGCTGCCGGTGGAAGTGATTATCCTCGAGGATAATCACTTCCACCGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123362.1-480s21c1
Sequence:CCGGTTCAACGAGGATGGTACAGTACTCGAGTACTGTACCATCCTCGTTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001123362.1-1838s21c1
Sequence:CCGGCCATCTATAGAACGCAGTAATCTCGAGATTACTGCGTTCTATAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123362.1-150s21c1
Sequence:CCGGTCCGACATCCTGCACAGTTTCCTCGAGGAAACTGTGCAGGATGTCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123362.1-533s21c1
Sequence:CCGGCCGAAGCTGGATGACCTACATCTCGAGATGTAGGTCATCCAGCTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001123362
PRDM12 MISSION shRNA shRNA Plasmid DNA
PR domain containing 12
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123362.1-312s21c1
Sequence:CCGGCTGCCGGTGGAAGTGATTATCCTCGAGGATAATCACTTCCACCGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123362.1-480s21c1
Sequence:CCGGTTCAACGAGGATGGTACAGTACTCGAGTACTGTACCATCCTCGTTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001123362.1-1838s21c1
Sequence:CCGGCCATCTATAGAACGCAGTAATCTCGAGATTACTGCGTTCTATAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123362.1-150s21c1
Sequence:CCGGTCCGACATCCTGCACAGTTTCCTCGAGGAAACTGTGCAGGATGTCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123362.1-533s21c1
Sequence:CCGGCCGAAGCTGGATGACCTACATCTCGAGATGTAGGTCATCCAGCTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001123362
PRDM12 MISSION shRNA Lentiviral Transduction Particles
PR domain containing 12
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123362.1-312s21c1
Sequence:CCGGCTGCCGGTGGAAGTGATTATCCTCGAGGATAATCACTTCCACCGGCAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000239063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123362.1-480s21c1
Sequence:CCGGTTCAACGAGGATGGTACAGTACTCGAGTACTGTACCATCCTCGTTGAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000239062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001123362.1-1838s21c1
Sequence:CCGGCCATCTATAGAACGCAGTAATCTCGAGATTACTGCGTTCTATAGATGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000239066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123362.1-150s21c1
Sequence:CCGGTCCGACATCCTGCACAGTTTCCTCGAGGAAACTGTGCAGGATGTCGGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000239065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123362.1-533s21c1
Sequence:CCGGCCGAAGCTGGATGACCTACATCTCGAGATGTAGGTCATCCAGCTTCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???