EMAIL THIS PAGE TO A FRIEND

PRDM13

PR domain containing 13

99 Gene Product Result for
Synonyms: MU-MB-20.220 PFM10
UniProtKB ID: Q9H4Q3, Q5TGC1, Q5TGC2
Gene ID:
Mouse(230025) PR domain containing 13
Rat(689695) PR domain containing 13
Zebrafish(796276) PR domain containing 13
dog(481934) PR domain containing 13
domestic cat(101087405) PR domain containing 13
cow(510505) PR domain containing 13
sheep(101112324) PR domain containing 13
naked mole-rat(101712688) PR domain containing 13
domestic guinea pig(100714746) PR domain containing 13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021620 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021620 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021620 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001080771 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001080771 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001080771 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU035881 MISSION® esiRNA targeting human PRDM13 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021620 Rosetta Predictions human pricing
XM_001071683 Rosetta Predictions rat pricing
NM_001080771 Rosetta Predictions mouse pricing
XM_131309 Rosetta Predictions mouse pricing
XM_884367 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021620 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354953 predicted 2717
2 SASI_Hs01_00132164 predicted 2428
3 SASI_Hs01_00132166 predicted 513
4 SASI_Hs01_00132168 predicted 340
5 SASI_Hs02_00354954 predicted 660
6 SASI_Hs01_00132169 predicted 2848
7 SASI_Hs02_00354955 predicted 2511
8 SASI_Hs01_00132170 predicted 2846
9 SASI_Hs02_00354956 predicted 929
10 SASI_Hs02_00354957 predicted 500
11 SASI_Hs01_00132165 predicted 2592
12 SASI_Hs01_00132167 predicted 2896
13 SASI_Hs01_00132171 predicted 2888
14 SASI_Hs01_00132172 predicted 525
15 SASI_Hs01_00132173 predicted 2901
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071683 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00336024 predicted 345
2 SASI_Rn02_00336025 predicted 432
3 SASI_Rn02_00336026 predicted 318
4 SASI_Rn02_00336027 predicted 468
5 SASI_Rn02_00336028 predicted 361
6 SASI_Rn02_00336029 predicted 651
7 SASI_Rn02_00336030 predicted 382
8 SASI_Rn02_00336031 predicted 299
9 SASI_Rn02_00336032 predicted 268
10 SASI_Rn02_00336033 predicted 351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080771 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293683 predicted 2604
2 SASI_Mm02_00293684 predicted 2827
3 SASI_Mm02_00293685 predicted 2675
4 SASI_Mm02_00293686 predicted 2490
5 SASI_Mm02_00293687 predicted 2354
6 SASI_Mm02_00293688 predicted 2594
7 SASI_Mm02_00293689 predicted 2176
8 SASI_Mm02_00293690 predicted 2920
9 SASI_Mm02_00293691 predicted 752
10 SASI_Mm02_00293692 predicted 574
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_131309 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00253588 predicted 2943
2 SASI_Mm01_00253589 predicted 2787
3 SASI_Mm01_00253590 predicted 2842
4 SASI_Mm01_00253591 predicted 2745
5 SASI_Mm01_00253592 predicted 2966
6 SASI_Mm01_00253593 predicted 2637
7 SASI_Mm01_00253594 predicted 2675
8 SASI_Mm01_00253595 predicted 2570
9 SASI_Mm01_00253596 predicted 2965
10 SASI_Mm01_00253597 predicted 2695
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_884367 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00210412 predicted 1782
2 SASI_Mm01_00210413 predicted 2440
3 SASI_Mm01_00210414 predicted 2392
4 SASI_Mm01_00210415 predicted 2292
5 SASI_Mm01_00210416 predicted 2327
6 SASI_Mm01_00210417 predicted 2214
7 SASI_Mm01_00210418 predicted 2345
8 SASI_Mm01_00210419 predicted 2335
9 SASI_Mm01_00210420 predicted 2076
10 SASI_Mm01_00210421 predicted 1884
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021620
PRDM13 MISSION shRNA Bacterial Glycerol Stock
PR domain containing 13
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021620.3-2866s21c1
Sequence:CCGGGGTAGATGTGACATCCATATACTCGAGTATATGGATGTCACATCTACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021620.2-1721s1c1
Sequence:CCGGCCGCTTATTACCCGCTCAAATCTCGAGATTTGAGCGGGTAATAAGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021620.2-609s1c1
Sequence:CCGGGCTGACAGTGTGGTATTCTAACTCGAGTTAGAATACCACACTGTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021620.2-535s1c1
Sequence:CCGGCTGGAAGCTATTGCAGACTTACTCGAGTAAGTCTGCAATAGCTTCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021620.2-714s1c1
Sequence:CCGGCTGCTGGAGGACGTTTAGATACTCGAGTATCTAAACGTCCTCCAGCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021620.2-2040s1c1
Sequence:CCGGGCGCAAGTATGGGCTCAAGATCTCGAGATCTTGAGCCCATACTTGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021620.3-680s21c1
Sequence:CCGGGGTACTGCTGGAGGACGTTTACTCGAGTAAACGTCCTCCAGCAGTACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021620.3-2566s21c1
Sequence:CCGGCAGTTCAGAGGTGGCGTAAATCTCGAGATTTACGCCACCTCTGAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021620
PRDM13 MISSION shRNA shRNA Plasmid DNA
PR domain containing 13
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021620.3-2866s21c1
Sequence:CCGGGGTAGATGTGACATCCATATACTCGAGTATATGGATGTCACATCTACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021620.2-1721s1c1
Sequence:CCGGCCGCTTATTACCCGCTCAAATCTCGAGATTTGAGCGGGTAATAAGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021620.2-609s1c1
Sequence:CCGGGCTGACAGTGTGGTATTCTAACTCGAGTTAGAATACCACACTGTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021620.2-535s1c1
Sequence:CCGGCTGGAAGCTATTGCAGACTTACTCGAGTAAGTCTGCAATAGCTTCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021620.2-714s1c1
Sequence:CCGGCTGCTGGAGGACGTTTAGATACTCGAGTATCTAAACGTCCTCCAGCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021620.2-2040s1c1
Sequence:CCGGGCGCAAGTATGGGCTCAAGATCTCGAGATCTTGAGCCCATACTTGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021620.3-680s21c1
Sequence:CCGGGGTACTGCTGGAGGACGTTTACTCGAGTAAACGTCCTCCAGCAGTACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021620.3-2566s21c1
Sequence:CCGGCAGTTCAGAGGTGGCGTAAATCTCGAGATTTACGCCACCTCTGAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021620
PRDM13 MISSION shRNA Lentiviral Transduction Particles
PR domain containing 13
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021620.3-2866s21c1
Sequence:CCGGGGTAGATGTGACATCCATATACTCGAGTATATGGATGTCACATCTACCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000018003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021620.2-1721s1c1
Sequence:CCGGCCGCTTATTACCCGCTCAAATCTCGAGATTTGAGCGGGTAATAAGCGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000018004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021620.2-609s1c1
Sequence:CCGGGCTGACAGTGTGGTATTCTAACTCGAGTTAGAATACCACACTGTCAGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000018005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021620.2-535s1c1
Sequence:CCGGCTGGAAGCTATTGCAGACTTACTCGAGTAAGTCTGCAATAGCTTCCAGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000018007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021620.2-714s1c1
Sequence:CCGGCTGCTGGAGGACGTTTAGATACTCGAGTATCTAAACGTCCTCCAGCAGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000018006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021620.2-2040s1c1
Sequence:CCGGGCGCAAGTATGGGCTCAAGATCTCGAGATCTTGAGCCCATACTTGCGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000378359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021620.3-680s21c1
Sequence:CCGGGGTACTGCTGGAGGACGTTTACTCGAGTAAACGTCCTCCAGCAGTACCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000358537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021620.3-2566s21c1
Sequence:CCGGCAGTTCAGAGGTGGCGTAAATCTCGAGATTTACGCCACCTCTGAACTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080771
PRDM13 MISSION shRNA Bacterial Glycerol Stock
PR domain containing 13
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239072    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080771.1-2957s21c1
Sequence:CCGGTTGGTCAAGTTGCAATTATTTCTCGAGAAATAATTGCAACTTGACCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080771.1-554s21c1
Sequence:CCGGTGGAAGCTATTGCAGACTTACCTCGAGGTAAGTCTGCAATAGCTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080771.1-686s21c1
Sequence:CCGGCTCCAACGCATGATGAGAAAGCTCGAGCTTTCTCATCATGCGTTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080771.1-628s21c1
Sequence:CCGGCTGACTGTGTGGTATTCTAACCTCGAGGTTAGAATACCACACAGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080771.1-502s21c1
Sequence:CCGGCTGGAGTGGATAGGGTTAATCCTCGAGGATTAACCCTATCCACTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080771
PRDM13 MISSION shRNA shRNA Plasmid DNA
PR domain containing 13
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239072    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080771.1-2957s21c1
Sequence:CCGGTTGGTCAAGTTGCAATTATTTCTCGAGAAATAATTGCAACTTGACCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080771.1-554s21c1
Sequence:CCGGTGGAAGCTATTGCAGACTTACCTCGAGGTAAGTCTGCAATAGCTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080771.1-686s21c1
Sequence:CCGGCTCCAACGCATGATGAGAAAGCTCGAGCTTTCTCATCATGCGTTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080771.1-628s21c1
Sequence:CCGGCTGACTGTGTGGTATTCTAACCTCGAGGTTAGAATACCACACAGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080771.1-502s21c1
Sequence:CCGGCTGGAGTGGATAGGGTTAATCCTCGAGGATTAACCCTATCCACTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080771
PRDM13 MISSION shRNA Lentiviral Transduction Particles
PR domain containing 13
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239072    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080771.1-2957s21c1
Sequence:CCGGTTGGTCAAGTTGCAATTATTTCTCGAGAAATAATTGCAACTTGACCAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000239074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080771.1-554s21c1
Sequence:CCGGTGGAAGCTATTGCAGACTTACCTCGAGGTAAGTCTGCAATAGCTTCCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000239076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080771.1-686s21c1
Sequence:CCGGCTCCAACGCATGATGAGAAAGCTCGAGCTTTCTCATCATGCGTTGGAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000239075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080771.1-628s21c1
Sequence:CCGGCTGACTGTGTGGTATTCTAACCTCGAGGTTAGAATACCACACAGTCAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000239073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080771.1-502s21c1
Sequence:CCGGCTGGAGTGGATAGGGTTAATCCTCGAGGATTAACCCTATCCACTCCAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???