EMAIL THIS PAGE TO A FRIEND

PRDM14

PR domain containing 14

49 Gene Product Result for
Synonyms: PFM11
UniProtKB ID: Q9GZV8, Q86UX9
Gene ID:
Human(63978) Summary: This gene encodes a member of the PRDI-BF1 and RIZ homology domain containing (PRDM) family of transcriptional regulators. The encoded protein may possess histone methyltransferase activity and plays a critical role in cell pluripotency by suppressing the expression of differentiation marker genes. Expression of this gene may play a role in breast cancer. [provided by RefSeq, Dec 2011]
Mouse(383491) PR domain containing 14
Rat(297769) PR domain containing 14
domestic guinea pig(100735710) PR domain containing 14
naked mole-rat(101725620) PR domain containing 14
Domestic Rabbit(100347807) PR domain containing 14
cow(100140032) PR domain containing 14
sheep(101114964) PR domain containing 14
Zebrafish(563151) PR domain containing 14
Horse(100062473) PR domain containing 14
chicken(428362) PR domain containing 14
domestic cat(101094397) PR domain containing 14
dog(486988) PR domain containing 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024504 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024504 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024504 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081209 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081209 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081209 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU146681 MISSION® esiRNA esiRNA targeting mouse Prdm14 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024504 Rosetta Predictions human pricing
NM_001081209 Rosetta Predictions mouse pricing
XM_357091 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024504 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154341 predicted 623
2 SASI_Hs01_00154342 predicted 697
3 SASI_Hs01_00154344 predicted 1592
4 SASI_Hs01_00154345 predicted 1107
5 SASI_Hs01_00154346 predicted 1607
6 SASI_Hs01_00154348 predicted 296
7 SASI_Hs01_00154349 predicted 1592
8 SASI_Hs01_00154350 predicted 1072
9 SASI_Hs02_00356772 predicted 1683
10 SASI_Hs02_00356773 predicted 1404
11 SASI_Hs01_00154343 predicted 1428
12 SASI_Hs01_00154347 predicted 902
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081209 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296251 predicted 1252
2 SASI_Mm02_00296252 predicted 1426
3 SASI_Mm02_00296253 predicted 391
4 SASI_Mm02_00296254 predicted 645
5 SASI_Mm02_00296255 predicted 336
6 SASI_Mm02_00296256 predicted 1264
7 SASI_Mm02_00296257 predicted 828
8 SASI_Mm02_00296258 predicted 1333
9 SASI_Mm02_00296259 predicted 692
10 SASI_Mm02_00296260 predicted 1426
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_357091 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00235854 predicted 1249
2 SASI_Mm01_00235855 predicted 1265
3 SASI_Mm01_00235856 predicted 555
4 SASI_Mm01_00235857 predicted 1255
5 SASI_Mm01_00235858 predicted 1271
6 SASI_Mm01_00235859 predicted 1330
7 SASI_Mm01_00235860 predicted 1428
8 SASI_Mm01_00235861 predicted 1269
9 SASI_Mm01_00235862 predicted 1239
10 SASI_Mm01_00235863 predicted 1721
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024504
PRDM14 MISSION shRNA Bacterial Glycerol Stock
PR domain containing 14
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024504.2-1227s21c1
Sequence:CCGGTGCAGTGTCAAGGGCATATATCTCGAGATATATGCCCTTGACACTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024504.2-1114s21c1
Sequence:CCGGGATCTTTGAAGATGGTCATTTCTCGAGAAATGACCATCTTCAAAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024504.2-692s21c1
Sequence:CCGGCTGAGGACCTCCCAGTTATTACTCGAGTAATAACTGGGAGGTCCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024504.2-943s21c1
Sequence:CCGGTCAACTTCCAGAAGGTCTATGCTCGAGCATAGACCTTCTGGAAGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024504.2-1544s1c1
Sequence:CCGGCGGATCCACATTCTTCATGTTCTCGAGAACATGAAGAATGTGGATCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024504.2-926s1c1
Sequence:CCGGCTGGATAAAGACTCCCTTCAACTCGAGTTGAAGGGAGTCTTTATCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024504.2-1599s1c1
Sequence:CCGGGTGGGAAATGTTTCTCTCAATCTCGAGATTGAGAGAAACATTTCCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024504.2-303s1c1
Sequence:CCGGCGTCCTATGGACACTACAGAACTCGAGTTCTGTAGTGTCCATAGGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024504.2-595s1c1
Sequence:CCGGCCAAATCATTGGTGGCGACAACTCGAGTTGTCGCCACCAATGATTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024504
PRDM14 MISSION shRNA shRNA Plasmid DNA
PR domain containing 14
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024504.2-1227s21c1
Sequence:CCGGTGCAGTGTCAAGGGCATATATCTCGAGATATATGCCCTTGACACTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024504.2-1114s21c1
Sequence:CCGGGATCTTTGAAGATGGTCATTTCTCGAGAAATGACCATCTTCAAAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024504.2-692s21c1
Sequence:CCGGCTGAGGACCTCCCAGTTATTACTCGAGTAATAACTGGGAGGTCCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024504.2-943s21c1
Sequence:CCGGTCAACTTCCAGAAGGTCTATGCTCGAGCATAGACCTTCTGGAAGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024504.2-1544s1c1
Sequence:CCGGCGGATCCACATTCTTCATGTTCTCGAGAACATGAAGAATGTGGATCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024504.2-926s1c1
Sequence:CCGGCTGGATAAAGACTCCCTTCAACTCGAGTTGAAGGGAGTCTTTATCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024504.2-1599s1c1
Sequence:CCGGGTGGGAAATGTTTCTCTCAATCTCGAGATTGAGAGAAACATTTCCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024504.2-303s1c1
Sequence:CCGGCGTCCTATGGACACTACAGAACTCGAGTTCTGTAGTGTCCATAGGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024504.2-595s1c1
Sequence:CCGGCCAAATCATTGGTGGCGACAACTCGAGTTGTCGCCACCAATGATTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024504
PRDM14 MISSION shRNA Lentiviral Transduction Particles
PR domain containing 14
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024504.2-1227s21c1
Sequence:CCGGTGCAGTGTCAAGGGCATATATCTCGAGATATATGCCCTTGACACTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024504.2-1114s21c1
Sequence:CCGGGATCTTTGAAGATGGTCATTTCTCGAGAAATGACCATCTTCAAAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024504.2-692s21c1
Sequence:CCGGCTGAGGACCTCCCAGTTATTACTCGAGTAATAACTGGGAGGTCCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024504.2-943s21c1
Sequence:CCGGTCAACTTCCAGAAGGTCTATGCTCGAGCATAGACCTTCTGGAAGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024504.2-1544s1c1
Sequence:CCGGCGGATCCACATTCTTCATGTTCTCGAGAACATGAAGAATGTGGATCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024504.2-926s1c1
Sequence:CCGGCTGGATAAAGACTCCCTTCAACTCGAGTTGAAGGGAGTCTTTATCCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024504.2-1599s1c1
Sequence:CCGGGTGGGAAATGTTTCTCTCAATCTCGAGATTGAGAGAAACATTTCCCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024504.2-303s1c1
Sequence:CCGGCGTCCTATGGACACTACAGAACTCGAGTTCTGTAGTGTCCATAGGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024504.2-595s1c1
Sequence:CCGGCCAAATCATTGGTGGCGACAACTCGAGTTGTCGCCACCAATGATTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081209
PRDM14 MISSION shRNA Bacterial Glycerol Stock
PR domain containing 14
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081209.2-391s21c1
Sequence:CCGGACTCCCGAAGTACCACGATTTCTCGAGAAATCGTGGTACTTCGGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081209.2-1676s21c1
Sequence:CCGGGCCGTAGCTCCTGCGATATTTCTCGAGAAATATCGCAGGAGCTACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081209.2-2301s21c1
Sequence:CCGGACCTTGAATTACAGGATTAAGCTCGAGCTTAATCCTGTAATTCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081209.2-560s21c1
Sequence:CCGGTTAAGTCGTCCCAGTCAATATCTCGAGATATTGACTGGGACGACTTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081209.2-341s21c1
Sequence:CCGGACAATCTGCCCTGGTACAAATCTCGAGATTTGTACCAGGGCAGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081209
PRDM14 MISSION shRNA shRNA Plasmid DNA
PR domain containing 14
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081209.2-391s21c1
Sequence:CCGGACTCCCGAAGTACCACGATTTCTCGAGAAATCGTGGTACTTCGGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081209.2-1676s21c1
Sequence:CCGGGCCGTAGCTCCTGCGATATTTCTCGAGAAATATCGCAGGAGCTACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081209.2-2301s21c1
Sequence:CCGGACCTTGAATTACAGGATTAAGCTCGAGCTTAATCCTGTAATTCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081209.2-560s21c1
Sequence:CCGGTTAAGTCGTCCCAGTCAATATCTCGAGATATTGACTGGGACGACTTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081209.2-341s21c1
Sequence:CCGGACAATCTGCCCTGGTACAAATCTCGAGATTTGTACCAGGGCAGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081209
PRDM14 MISSION shRNA Lentiviral Transduction Particles
PR domain containing 14
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081209.2-391s21c1
Sequence:CCGGACTCCCGAAGTACCACGATTTCTCGAGAAATCGTGGTACTTCGGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081209.2-1676s21c1
Sequence:CCGGGCCGTAGCTCCTGCGATATTTCTCGAGAAATATCGCAGGAGCTACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081209.2-2301s21c1
Sequence:CCGGACCTTGAATTACAGGATTAAGCTCGAGCTTAATCCTGTAATTCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081209.2-560s21c1
Sequence:CCGGTTAAGTCGTCCCAGTCAATATCTCGAGATATTGACTGGGACGACTTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081209.2-341s21c1
Sequence:CCGGACAATCTGCCCTGGTACAAATCTCGAGATTTGTACCAGGGCAGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)