EMAIL THIS PAGE TO A FRIEND

PRDM15

PR domain containing 15

70 Gene Product Result for
Synonyms: C21orf83 PFM15 ZNF298
UniProtKB ID: P57071, Q8N0X3, Q8NEX0, Q9NQV3
Gene ID:
Mouse(114604) PR domain containing 15
Rat(304054) PR domain containing 15
Zebrafish(566512) PR domain containing 15
Horse(100058322) PR domain containing 15
domestic cat(101095038) PR domain containing 15
chicken(418531) PR domain containing 15
dog(610905) PR domain containing 15
cow(514566) PR domain containing 15
sheep(101120466) PR domain containing 15
naked mole-rat(101714458) PR domain containing 15
domestic guinea pig(100732355) PR domain containing 15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_622716 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_622716 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_622716 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022115 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022115 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022115 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150441 MISSION® esiRNA esiRNA human PRDM15 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040424 Rosetta Predictions human pricing
NM_022115 Rosetta Predictions human pricing
NM_001107104 Rosetta Predictions rat pricing
XM_622716 Rosetta Predictions mouse pricing
XM_907577 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040424 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164126 predicted 2140
2 SASI_Hs01_00164127 predicted 1594
3 SASI_Hs01_00164128 predicted 971
4 SASI_Hs01_00164129 predicted 1314
5 SASI_Hs01_00164130 predicted 3082
6 SASI_Hs01_00164131 predicted 866
7 SASI_Hs01_00164132 predicted 1682
8 SASI_Hs01_00164134 predicted 1455
9 SASI_Hs01_00164135 predicted 1351
10 SASI_Hs02_00308951 predicted 1916
11 SASI_Hs01_00164133 predicted 1252
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022115 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210966 predicted 3134
2 SASI_Hs01_00210967 predicted 2592
3 SASI_Hs01_00210968 predicted 1968
4 SASI_Hs01_00210969 predicted 2311
5 SASI_Hs01_00210970 predicted 4075
6 SASI_Hs01_00210971 predicted 1853
7 SASI_Hs01_00210972 predicted 2681
8 SASI_Hs01_00210974 predicted 2455
9 SASI_Hs01_00210975 predicted 2343
10 SASI_Hs02_00355508 predicted 2915
11 SASI_Hs01_00210973 predicted 2257
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107104 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225536 predicted 2250
2 SASI_Rn02_00225537 predicted 324
3 SASI_Rn02_00225538 predicted 365
4 SASI_Rn02_00225539 predicted 307
5 SASI_Rn02_00225540 predicted 3029
6 SASI_Rn02_00225541 predicted 2187
7 SASI_Rn02_00225542 predicted 544
8 SASI_Rn02_00225543 predicted 2836
9 SASI_Rn02_00225544 predicted 2264
10 SASI_Rn02_00225545 predicted 2909
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_622716 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00254504 predicted 3242
2 SASI_Mm01_00254505 predicted 3243
3 SASI_Mm02_00427940 predicted 3238
4 SASI_Mm01_00254506 predicted 3310
5 SASI_Mm01_00254507 predicted 3195
6 SASI_Mm01_00254508 predicted 3175
7 SASI_Mm01_00254509 predicted 3330
8 SASI_Mm01_00254510 predicted 3198
9 SASI_Mm01_00254511 predicted 2993
10 SASI_Mm01_00254512 predicted 2916
11 SASI_Mm01_00254513 predicted 3200
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_907577 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00433386 predicted 198
2 SASI_Mm02_00433387 predicted 1481
3 SASI_Mm02_00433388 predicted 383
4 SASI_Mm02_00433389 predicted 1135
5 SASI_Mm02_00433390 predicted 2539
6 SASI_Mm02_00433391 predicted 2915
7 SASI_Mm02_00433392 predicted 619
8 SASI_Mm02_00433393 predicted 2030
9 SASI_Mm02_00433394 predicted 2196
10 SASI_Mm02_00433395 predicted 2744
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_622716
VALIDATED
PRDM15 MISSION shRNA Bacterial Glycerol Stock
PR domain containing 15
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000226356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_622716.4-5895s21c1
Sequence:CCGGTATGTCTAGGTTCGCATAAATCTCGAGATTTATGCGAACCTAGACATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_622716.4-1029s21c1
Sequence:CCGGTGAGCAGCCTCTGGTCATTATCTCGAGATAATGACCAGAGGCTGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_622716.4-591s21c1
Sequence:CCGGACATGGCAGTGACGTGTATTTCTCGAGAAATACACGTCACTGCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_622716.4-1969s21c1
Sequence:CCGGTTCAAGGACATCGCGCTAATGCTCGAGCATTAGCGCGATGTCCTTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_622716.4-457s21c1
Sequence:GTACCGGGCATTTCCTCTGAAGGTATTTCTCGAGAAATACCTTCAGAGGAAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_622716
VALIDATED
PRDM15 MISSION shRNA shRNA Plasmid DNA
PR domain containing 15
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000226356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_622716.4-5895s21c1
Sequence:CCGGTATGTCTAGGTTCGCATAAATCTCGAGATTTATGCGAACCTAGACATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_622716.4-1029s21c1
Sequence:CCGGTGAGCAGCCTCTGGTCATTATCTCGAGATAATGACCAGAGGCTGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_622716.4-591s21c1
Sequence:CCGGACATGGCAGTGACGTGTATTTCTCGAGAAATACACGTCACTGCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_622716.4-1969s21c1
Sequence:CCGGTTCAAGGACATCGCGCTAATGCTCGAGCATTAGCGCGATGTCCTTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_622716.4-457s21c1
Sequence:GTACCGGGCATTTCCTCTGAAGGTATTTCTCGAGAAATACCTTCAGAGGAAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_622716
VALIDATED
PRDM15 MISSION shRNA Lentiviral Transduction Particles
PR domain containing 15
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000226356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_622716.4-5895s21c1
Sequence:CCGGTATGTCTAGGTTCGCATAAATCTCGAGATTTATGCGAACCTAGACATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_622716.4-1029s21c1
Sequence:CCGGTGAGCAGCCTCTGGTCATTATCTCGAGATAATGACCAGAGGCTGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_622716.4-591s21c1
Sequence:CCGGACATGGCAGTGACGTGTATTTCTCGAGAAATACACGTCACTGCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_622716.4-1969s21c1
Sequence:CCGGTTCAAGGACATCGCGCTAATGCTCGAGCATTAGCGCGATGTCCTTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_622716.4-457s21c1
Sequence:GTACCGGGCATTTCCTCTGAAGGTATTTCTCGAGAAATACCTTCAGAGGAAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022115
PRDM15 MISSION shRNA Bacterial Glycerol Stock
PR domain containing 15
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022115.2-1839s1c1
Sequence:CCGGGCTCCTCAATGAACATCTGTTCTCGAGAACAGATGTTCATTGAGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022115.2-243s1c1
Sequence:CCGGCCGACTGTTCTTTGTTACATTCTCGAGAATGTAACAAAGAACAGTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022115.3-2434s21c1
Sequence:CCGGAGCCGCAAAGAGAGCCTAAAGCTCGAGCTTTAGGCTCTCTTTGCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022115.3-794s21c1
Sequence:CCGGAGATACCTTTGAACGTGAATACTCGAGTATTCACGTTCAAAGGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022115.3-2240s21c1
Sequence:CCGGCGCTCAAGAGGAGCTTAATTCCTCGAGGAATTAAGCTCCTCTTGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022115.2-792s1c1
Sequence:CCGGCGAGATACCTTTGAACGTGAACTCGAGTTCACGTTCAAAGGTATCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022115.3-2387s21c1
Sequence:CCGGCGCATGGTGACAAGCTGTTTACTCGAGTAAACAGCTTGTCACCATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022115
PRDM15 MISSION shRNA shRNA Plasmid DNA
PR domain containing 15
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022115.2-1839s1c1
Sequence:CCGGGCTCCTCAATGAACATCTGTTCTCGAGAACAGATGTTCATTGAGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022115.2-243s1c1
Sequence:CCGGCCGACTGTTCTTTGTTACATTCTCGAGAATGTAACAAAGAACAGTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022115.3-2434s21c1
Sequence:CCGGAGCCGCAAAGAGAGCCTAAAGCTCGAGCTTTAGGCTCTCTTTGCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022115.3-794s21c1
Sequence:CCGGAGATACCTTTGAACGTGAATACTCGAGTATTCACGTTCAAAGGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022115.3-2240s21c1
Sequence:CCGGCGCTCAAGAGGAGCTTAATTCCTCGAGGAATTAAGCTCCTCTTGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022115.2-792s1c1
Sequence:CCGGCGAGATACCTTTGAACGTGAACTCGAGTTCACGTTCAAAGGTATCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022115.3-2387s21c1
Sequence:CCGGCGCATGGTGACAAGCTGTTTACTCGAGTAAACAGCTTGTCACCATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022115
PRDM15 MISSION shRNA Lentiviral Transduction Particles
PR domain containing 15
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022115.2-1839s1c1
Sequence:CCGGGCTCCTCAATGAACATCTGTTCTCGAGAACAGATGTTCATTGAGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022115.2-243s1c1
Sequence:CCGGCCGACTGTTCTTTGTTACATTCTCGAGAATGTAACAAAGAACAGTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022115.3-2434s21c1
Sequence:CCGGAGCCGCAAAGAGAGCCTAAAGCTCGAGCTTTAGGCTCTCTTTGCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022115.3-794s21c1
Sequence:CCGGAGATACCTTTGAACGTGAATACTCGAGTATTCACGTTCAAAGGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022115.3-2240s21c1
Sequence:CCGGCGCTCAAGAGGAGCTTAATTCCTCGAGGAATTAAGCTCCTCTTGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022115.2-792s1c1
Sequence:CCGGCGAGATACCTTTGAACGTGAACTCGAGTTCACGTTCAAAGGTATCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022115.3-2387s21c1
Sequence:CCGGCGCATGGTGACAAGCTGTTTACTCGAGTAAACAGCTTGTCACCATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)