EMAIL THIS PAGE TO A FRIEND

PRDM1

PR domain containing 1, with ZNF domain

142 Gene Product Result for
Synonyms: BLIMP1 PRDI-BF1
UniProtKB ID: O75626, B2REA6, E1P5E0, Q86WM7
Gene ID:
Human(639) Summary: This gene encodes a protein that acts as a repressor of beta-interferon gene expression. The protein binds specifically to the PRDI (positive regulatory domain I element) of the beta-IFN gene promoter. Transcription of this gene increases upon virus induction. Two alternatively spliced transcript variants that encode different isoforms have been reported. [provided by RefSeq, Jul 2008]
Mouse(12142) PR domain containing 1, with ZNF domain
Rat(309871) PR domain containing 1, with ZNF domain
chicken(445340) PR domain containing 1, with ZNF domain
domestic cat(101091697) PR domain containing 1, with ZNF domain
Horse(100071967) PR domain containing 1, with ZNF domain
dog(481947) PR domain containing 1, with ZNF domain
cow(538384) PR domain containing 1, with ZNF domain
sheep(101121017) PR domain containing 1, with ZNF domain
domestic guinea pig(100727010) PR domain containing 1, with ZNF domain
naked mole-rat(101707985) PR domain containing 1, with ZNF domain
Domestic Rabbit(100338324) PR domain containing 1, with ZNF domain
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
PRS3991 Anti-Blimp-1 (ab2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
R7032 Anti-PRDM1 (121-135) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
R7157 Anti-PRDM1 (551-565) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
05-1570 Anti-PRDM1 (BLIMP-1) Antibody, clone 6D3 clone 6D3, from rat human, mouse
ELISA, flow cytometry, immunohistochemistry, western blot pricing
SAB2501378 Anti-PRDM1 (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, human, rat, canine
ELISA, immunohistochemistry, western blot pricing
SAB2501379 Anti-PRDM1 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, bovine, rat, pig, human, canine
ELISA, western blot pricing
SAB1412469 ANTI-PRDM1 antibody produced in mouse clone 1G6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412631 ANTI-PRDM1 antibody produced in mouse clone 4A6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA030033 Anti-PRDM1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry pricing
MABD129 Anti-PRDM1 Antibody, clone 5E7 ascites fluid, clone 5E7, from mouse human
western blot pricing
WH0000639M1 Monoclonal Anti-PRDM1 antibody produced in mouse clone 2B10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007548 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007548 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007548 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001198 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001198 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001198 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU130211 MISSION® esiRNA esiRNA human PRDM1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001198 Rosetta Predictions human pricing
NM_182907 Rosetta Predictions human pricing
NM_001107639 Rosetta Predictions rat pricing
NM_007548 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001198 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331338 predicted 2033
2 SASI_Hs01_00109276 predicted 2387
3 SASI_Hs01_00109277 predicted 2536
4 SASI_Hs01_00109278 predicted 880
5 SASI_Hs01_00109279 predicted 2674
6 SASI_Hs01_00109280 predicted 2478
7 SASI_Hs01_00109281 predicted 870
8 SASI_Hs01_00109282 predicted 2504
9 SASI_Hs01_00109283 predicted 1889
10 SASI_Hs01_00109284 predicted 2627
11 SASI_Hs01_00109275 predicted 2665
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182907 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371011 predicted 1543
2 SASI_Hs01_00140772 predicted 1894
3 SASI_Hs01_00140773 predicted 2042
4 SASI_Hs01_00140774 predicted 393
5 SASI_Hs01_00140775 predicted 2181
6 SASI_Hs01_00140776 predicted 1987
7 SASI_Hs01_00140777 predicted 381
8 SASI_Hs01_00140778 predicted 2011
9 SASI_Hs01_00140779 predicted 1401
10 SASI_Hs01_00140780 predicted 2134
11 SASI_Hs01_00140771 predicted 2183
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107639 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230815 predicted 2611
2 SASI_Rn02_00230816 predicted 2124
3 SASI_Rn02_00230817 predicted 864
4 SASI_Rn02_00230818 predicted 1013
5 SASI_Rn02_00230819 predicted 1932
6 SASI_Rn02_00230820 predicted 365
7 SASI_Rn02_00230821 predicted 508
8 SASI_Rn02_00230822 predicted 524
9 SASI_Rn02_00230823 predicted 2291
10 SASI_Rn02_00230824 predicted 623
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007548 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311901 predicted 2604
2 SASI_Mm01_00154523 predicted 1430
3 SASI_Mm02_00311902 predicted 2482
4 SASI_Mm01_00154525 predicted 464
5 SASI_Mm01_00154526 predicted 965
6 SASI_Mm01_00154527 predicted 722
7 SASI_Mm01_00154528 predicted 1830
8 SASI_Mm01_00154529 predicted 2088
9 SASI_Mm01_00154530 predicted 1884
10 SASI_Mm02_00311903 predicted 2610
11 SASI_Mm01_00154524 predicted 237
12 SASI_Mm01_00154531 predicted 1124
13 SASI_Mm01_00154532 predicted 973
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007548
VALIDATED
PRDM1 MISSION shRNA Bacterial Glycerol Stock
PR domain containing 1, with ZNF domain
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007548.1-2305s1c1
Sequence:CCGGCCCTGCCAAGTTTACGCAATTCTCGAGAATTGCGTAAACTTGGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084713    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007548.1-3347s1c1
Sequence:CCGGGCAACCTTTCTCTATGATAATCTCGAGATTATCATAGAGAAAGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007548.1-1945s1c1
Sequence:CCGGCGGAGCCATGAATCTCATTAACTCGAGTTAATGAGATTCATGGCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007548.1-1650s1c1
Sequence:CCGGCCGTCTACAGTAACCTCCTTACTCGAGTAAGGAGGTTACTGTAGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007548.1-616s1c1
Sequence:CCGGCGTGGTAAGTAAGGAGTACATCTCGAGATGTACTCCTTACTTACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007548.3-2368s21c1
Sequence:CCGGGGTTCGACATCAGCGACAATGCTCGAGCATTGTCGCTGATGTCGAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007548.3-1417s21c1
Sequence:CCGGTGTTGCCACCGTACGGCATTACTCGAGTAATGCCGTACGGTGGCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235770    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007548.3-2984s21c1
Sequence:CCGGACTATTGCCTAGCCATAATTACTCGAGTAATTATGGCTAGGCAATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007548.3-290s21c1
Sequence:CCGGGGACATGGAGGACGCTGATATCTCGAGATATCAGCGTCCTCCATGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007548.3-719s21c1
Sequence:CCGGCATCTACTTCTACACTATTAACTCGAGTTAATAGTGTAGAAGTAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007548
VALIDATED
PRDM1 MISSION shRNA shRNA Plasmid DNA
PR domain containing 1, with ZNF domain
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007548.1-2305s1c1
Sequence:CCGGCCCTGCCAAGTTTACGCAATTCTCGAGAATTGCGTAAACTTGGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084713    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007548.1-3347s1c1
Sequence:CCGGGCAACCTTTCTCTATGATAATCTCGAGATTATCATAGAGAAAGGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007548.1-1945s1c1
Sequence:CCGGCGGAGCCATGAATCTCATTAACTCGAGTTAATGAGATTCATGGCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007548.1-1650s1c1
Sequence:CCGGCCGTCTACAGTAACCTCCTTACTCGAGTAAGGAGGTTACTGTAGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007548.1-616s1c1
Sequence:CCGGCGTGGTAAGTAAGGAGTACATCTCGAGATGTACTCCTTACTTACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007548.3-2368s21c1
Sequence:CCGGGGTTCGACATCAGCGACAATGCTCGAGCATTGTCGCTGATGTCGAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007548.3-1417s21c1
Sequence:CCGGTGTTGCCACCGTACGGCATTACTCGAGTAATGCCGTACGGTGGCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235770    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007548.3-2984s21c1
Sequence:CCGGACTATTGCCTAGCCATAATTACTCGAGTAATTATGGCTAGGCAATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007548.3-290s21c1
Sequence:CCGGGGACATGGAGGACGCTGATATCTCGAGATATCAGCGTCCTCCATGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007548.3-719s21c1
Sequence:CCGGCATCTACTTCTACACTATTAACTCGAGTTAATAGTGTAGAAGTAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007548
VALIDATED
PRDM1 MISSION shRNA Lentiviral Transduction Particles
PR domain containing 1, with ZNF domain
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007548.1-2305s1c1
Sequence:CCGGCCCTGCCAAGTTTACGCAATTCTCGAGAATTGCGTAAACTTGGCAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000084713    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007548.1-3347s1c1
Sequence:CCGGGCAACCTTTCTCTATGATAATCTCGAGATTATCATAGAGAAAGGTTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000084716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007548.1-1945s1c1
Sequence:CCGGCGGAGCCATGAATCTCATTAACTCGAGTTAATGAGATTCATGGCTCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000084717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007548.1-1650s1c1
Sequence:CCGGCCGTCTACAGTAACCTCCTTACTCGAGTAAGGAGGTTACTGTAGACGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000084715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007548.1-616s1c1
Sequence:CCGGCGTGGTAAGTAAGGAGTACATCTCGAGATGTACTCCTTACTTACCACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000235768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007548.3-2368s21c1
Sequence:CCGGGGTTCGACATCAGCGACAATGCTCGAGCATTGTCGCTGATGTCGAACCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000235769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007548.3-1417s21c1
Sequence:CCGGTGTTGCCACCGTACGGCATTACTCGAGTAATGCCGTACGGTGGCAACATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000235770    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007548.3-2984s21c1
Sequence:CCGGACTATTGCCTAGCCATAATTACTCGAGTAATTATGGCTAGGCAATAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000235772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007548.3-290s21c1
Sequence:CCGGGGACATGGAGGACGCTGATATCTCGAGATATCAGCGTCCTCCATGTCCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000235771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007548.3-719s21c1
Sequence:CCGGCATCTACTTCTACACTATTAACTCGAGTTAATAGTGTAGAAGTAGATGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001198
PRDM1 MISSION shRNA Bacterial Glycerol Stock
PR domain containing 1, with ZNF domain
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001198.2-4984s1c1
Sequence:CCGGGCCCACAATCAACAGTGGTTTCTCGAGAAACCACTGTTGATTGTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001198.2-1483s1c1
Sequence:CCGGCCCTACGGCATGAATTGTAATCTCGAGATTACAATTCATGCCGTAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001198.2-768s1c1
Sequence:CCGGCGGGATGAACATCTACTTCTACTCGAGTAGAAGTAGATGTTCATCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001198.2-2546s1c1
Sequence:CCGGGCCTGAAAGTGTCTTTGCAAACTCGAGTTTGCAAAGACACTTTCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001198.2-1866s1c1
Sequence:CCGGCGAAGCCATGAATCTCATTAACTCGAGTTAATGAGATTCATGGCTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001198.3-777s21c1
Sequence:CCGGCATCTACTTCTACACCATTAACTCGAGTTAATGGTGTAGAAGTAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001198.3-669s21c1
Sequence:CCGGCCACTTCATTGACGGCTTTAACTCGAGTTAAAGCCGTCAATGAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001198.3-1865s21c1
Sequence:GTACCGGACGAAGCCATGAATCTCATTACTCGAGTAATGAGATTCATGGCTTCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235670    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001198.3-3019s21c1
Sequence:CCGGTCCCATTACTAAGACTATTACCTCGAGGTAATAGTCTTAGTAATGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001198.3-512s21c1
Sequence:CCGGCCAACAGTGAAGAGGTTATTGCTCGAGCAATAACCTCTTCACTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001198
PRDM1 MISSION shRNA shRNA Plasmid DNA
PR domain containing 1, with ZNF domain
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001198.2-4984s1c1
Sequence:CCGGGCCCACAATCAACAGTGGTTTCTCGAGAAACCACTGTTGATTGTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001198.2-1483s1c1
Sequence:CCGGCCCTACGGCATGAATTGTAATCTCGAGATTACAATTCATGCCGTAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001198.2-768s1c1
Sequence:CCGGCGGGATGAACATCTACTTCTACTCGAGTAGAAGTAGATGTTCATCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001198.2-2546s1c1
Sequence:CCGGGCCTGAAAGTGTCTTTGCAAACTCGAGTTTGCAAAGACACTTTCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001198.2-1866s1c1
Sequence:CCGGCGAAGCCATGAATCTCATTAACTCGAGTTAATGAGATTCATGGCTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001198.3-777s21c1
Sequence:CCGGCATCTACTTCTACACCATTAACTCGAGTTAATGGTGTAGAAGTAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001198.3-669s21c1
Sequence:CCGGCCACTTCATTGACGGCTTTAACTCGAGTTAAAGCCGTCAATGAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001198.3-1865s21c1
Sequence:GTACCGGACGAAGCCATGAATCTCATTACTCGAGTAATGAGATTCATGGCTTCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235670    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001198.3-3019s21c1
Sequence:CCGGTCCCATTACTAAGACTATTACCTCGAGGTAATAGTCTTAGTAATGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001198.3-512s21c1
Sequence:CCGGCCAACAGTGAAGAGGTTATTGCTCGAGCAATAACCTCTTCACTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001198
PRDM1 MISSION shRNA Lentiviral Transduction Particles
PR domain containing 1, with ZNF domain
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001198.2-4984s1c1
Sequence:CCGGGCCCACAATCAACAGTGGTTTCTCGAGAAACCACTGTTGATTGTGGGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000013611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001198.2-1483s1c1
Sequence:CCGGCCCTACGGCATGAATTGTAATCTCGAGATTACAATTCATGCCGTAGGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000013609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001198.2-768s1c1
Sequence:CCGGCGGGATGAACATCTACTTCTACTCGAGTAGAAGTAGATGTTCATCCCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000013612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001198.2-2546s1c1
Sequence:CCGGGCCTGAAAGTGTCTTTGCAAACTCGAGTTTGCAAAGACACTTTCAGGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000013610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001198.2-1866s1c1
Sequence:CCGGCGAAGCCATGAATCTCATTAACTCGAGTTAATGAGATTCATGGCTTCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000235671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001198.3-777s21c1
Sequence:CCGGCATCTACTTCTACACCATTAACTCGAGTTAATGGTGTAGAAGTAGATGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000235669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001198.3-669s21c1
Sequence:CCGGCCACTTCATTGACGGCTTTAACTCGAGTTAAAGCCGTCAATGAAGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000218813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001198.3-1865s21c1
Sequence:GTACCGGACGAAGCCATGAATCTCATTACTCGAGTAATGAGATTCATGGCTTCGTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000235670    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001198.3-3019s21c1
Sequence:CCGGTCCCATTACTAAGACTATTACCTCGAGGTAATAGTCTTAGTAATGGGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000235668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001198.3-512s21c1
Sequence:CCGGCCAACAGTGAAGAGGTTATTGCTCGAGCAATAACCTCTTCACTGTTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???