EMAIL THIS PAGE TO A FRIEND

PRDM2

PR domain containing 2, with ZNF domain

327 Gene Product Result for
Synonyms: HUMHOXY1 KMT8 MTB-ZF RIZ RIZ1 RIZ2
UniProtKB ID: Q13029, B1AJZ4, Q13149, Q14550, Q5VUL9
Gene ID:
Human(7799) Summary: This tumor suppressor gene is a member of a nuclear histone/protein methyltransferase superfamily. It encodes a zinc finger protein that can bind to retinoblastoma protein, estrogen receptor, and the TPA-responsive element (MTE) of the heme-oxygenase-1 gene. Although the functions of this protein have not been fully characterized, it may (1) play a role in transcriptional regulation during neuronal differentiation and pathogenesis of retinoblastoma, (2) act as a transcriptional activator of the heme-oxygenase-1 gene, and (3) be a specific effector of estrogen action. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Mouse(110593) PR domain containing 2, with ZNF domain
Rat(313678) PR domain containing 2, with ZNF domain
chicken(419478) PR domain containing 2, with ZNF domain
domestic cat(101082169) PR domain containing 2, with ZNF domain
Horse(100054973) PR domain containing 2, with ZNF domain
dog(100688431) PR domain containing 2, with ZNF domain
cow(789222) PR domain containing 2, with ZNF domain
sheep(101110691) PR domain containing 2, with ZNF domain
naked mole-rat(101699822) PR domain containing 2, with ZNF domain
Domestic Rabbit(100350859) PR domain containing 2, with ZNF domain
domestic guinea pig(100716644) PR domain containing 2, with ZNF domain
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012231 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012231 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012231 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081355 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081355 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081355 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU193521 MISSION® esiRNA esiRNA targeting mouse Prdm2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007257 Rosetta Predictions human pricing
NM_012231 Rosetta Predictions human pricing
NM_015866 Rosetta Predictions human pricing
NM_001077648 Rosetta Predictions rat pricing
NM_001081355 Rosetta Predictions mouse pricing
XM_898822 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007257 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068779 predicted 681
2 SASI_Hs01_00068781 predicted 3231
3 SASI_Hs01_00068782 predicted 3464
4 SASI_Hs01_00068783 predicted 3571
5 SASI_Hs01_00068784 predicted 3024
6 SASI_Hs01_00068785 predicted 4375
7 SASI_Hs01_00068786 predicted 1694
8 SASI_Hs01_00068787 predicted 2067
9 SASI_Hs02_00305282 predicted 2124
10 SASI_Hs01_00068788 predicted 3638
11 SASI_Hs01_00068780 predicted 722
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012231 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141894 predicted 1944
2 SASI_Hs01_00141896 predicted 4491
3 SASI_Hs01_00141897 predicted 4726
4 SASI_Hs01_00141898 predicted 4829
5 SASI_Hs01_00141899 predicted 4286
6 SASI_Hs01_00141900 predicted 5642
7 SASI_Hs01_00141901 predicted 2952
8 SASI_Hs01_00141902 predicted 3319
9 SASI_Hs02_00343915 predicted 3382
10 SASI_Hs01_00141903 predicted 4906
11 SASI_Hs01_00141895 predicted 1981
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015866 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240686 predicted 1944
2 SASI_Hs01_00240688 predicted 4496
3 SASI_Hs01_00240689 predicted 4728
4 SASI_Hs01_00240690 predicted 4825
5 SASI_Hs01_00240691 predicted 4284
6 SASI_Hs01_00240692 predicted 5633
7 SASI_Hs01_00240693 predicted 2949
8 SASI_Hs01_00240694 predicted 3325
9 SASI_Hs02_00348449 predicted 3381
10 SASI_Hs01_00240695 predicted 4906
11 SASI_Hs01_00240687 predicted 1987
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077648 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207712 predicted 3638
2 SASI_Rn02_00207713 predicted 4835
3 SASI_Rn02_00207714 predicted 1992
4 SASI_Rn02_00207715 predicted 3626
5 SASI_Rn02_00207716 predicted 1357
6 SASI_Rn02_00207717 predicted 4080
7 SASI_Rn02_00207718 predicted 4004
8 SASI_Rn02_00207719 predicted 4610
9 SASI_Rn02_00207720 predicted 1911
10 SASI_Rn02_00207721 predicted 2020
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081355 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297601 predicted 1927
2 SASI_Mm02_00297602 predicted 2573
3 SASI_Mm02_00297603 predicted 1334
4 SASI_Mm02_00297604 predicted 4821
5 SASI_Mm02_00297605 predicted 1839
6 SASI_Mm02_00297606 predicted 3539
7 SASI_Mm02_00297607 predicted 1307
8 SASI_Mm02_00297608 predicted 1889
9 SASI_Mm02_00297609 predicted 562
10 SASI_Mm02_00297610 predicted 1869
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898822 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00265977 predicted 2577
2 SASI_Mm01_00265978 predicted 4831
3 SASI_Mm01_00265979 predicted 1864
4 SASI_Mm01_00265980 predicted 1848
5 SASI_Mm01_00265981 predicted 3548
6 SASI_Mm01_00265982 predicted 1309
7 SASI_Mm01_00265983 predicted 1903
8 SASI_Mm01_00265984 predicted 572
9 SASI_Mm01_00265985 predicted 1866
10 SASI_Mm01_00265986 predicted 3653
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012231
VALIDATED
PRDM2 MISSION shRNA Bacterial Glycerol Stock
PR domain containing 2, with ZNF domain
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012231.2-7301s1c1
Sequence:CCGGCCTGACTGTAAATGCTCCATTCTCGAGAATGGAGCATTTACAGTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012231.2-2010s1c1
Sequence:CCGGCCGTCAATCATGCTTTCAAATCTCGAGATTTGAAAGCATGATTGACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012231.2-5094s1c1
Sequence:CCGGCGTCGAATAAGCTCAAATTAACTCGAGTTAATTTGAGCTTATTCGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_012231.2-3472s1c1
Sequence:CCGGGCCTACGTGTAGTGCTGTAAACTCGAGTTTACAGCACTACACGTAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012231.3-2632s21c1
Sequence:CCGGGGCAGATTTGTATGGTATAAACTCGAGTTTATACCATACAAATCTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012231.3-4657s21c1
Sequence:CCGGAGAGCTTTACACGACTATAAACTCGAGTTTATAGTCGTGTAAAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012231.3-1986s21c1
Sequence:GTACCGGGTCACATGCATATCCATATATCTCGAGATATATGGATATGCATGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218523    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012231.3-7143s21c1
Sequence:GTACCGGTTCAAGAGTGAGCTATCAAACCTCGAGGTTTGATAGCTCACTCTTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012231.3-5405s21c1
Sequence:CCGGACAGCGGATGCGGAGATTAAACTCGAGTTTAATCTCCGCATCCGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012231
VALIDATED
PRDM2 MISSION shRNA shRNA Plasmid DNA
PR domain containing 2, with ZNF domain
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012231.2-7301s1c1
Sequence:CCGGCCTGACTGTAAATGCTCCATTCTCGAGAATGGAGCATTTACAGTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012231.2-2010s1c1
Sequence:CCGGCCGTCAATCATGCTTTCAAATCTCGAGATTTGAAAGCATGATTGACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012231.2-5094s1c1
Sequence:CCGGCGTCGAATAAGCTCAAATTAACTCGAGTTAATTTGAGCTTATTCGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_012231.2-3472s1c1
Sequence:CCGGGCCTACGTGTAGTGCTGTAAACTCGAGTTTACAGCACTACACGTAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012231.3-2632s21c1
Sequence:CCGGGGCAGATTTGTATGGTATAAACTCGAGTTTATACCATACAAATCTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012231.3-4657s21c1
Sequence:CCGGAGAGCTTTACACGACTATAAACTCGAGTTTATAGTCGTGTAAAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012231.3-1986s21c1
Sequence:GTACCGGGTCACATGCATATCCATATATCTCGAGATATATGGATATGCATGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218523    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012231.3-7143s21c1
Sequence:GTACCGGTTCAAGAGTGAGCTATCAAACCTCGAGGTTTGATAGCTCACTCTTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012231.3-5405s21c1
Sequence:CCGGACAGCGGATGCGGAGATTAAACTCGAGTTTAATCTCCGCATCCGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012231
VALIDATED
PRDM2 MISSION shRNA Lentiviral Transduction Particles
PR domain containing 2, with ZNF domain
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012231.2-7301s1c1
Sequence:CCGGCCTGACTGTAAATGCTCCATTCTCGAGAATGGAGCATTTACAGTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012231.2-2010s1c1
Sequence:CCGGCCGTCAATCATGCTTTCAAATCTCGAGATTTGAAAGCATGATTGACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012231.2-5094s1c1
Sequence:CCGGCGTCGAATAAGCTCAAATTAACTCGAGTTAATTTGAGCTTATTCGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_012231.2-3472s1c1
Sequence:CCGGGCCTACGTGTAGTGCTGTAAACTCGAGTTTACAGCACTACACGTAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012231.3-2632s21c1
Sequence:CCGGGGCAGATTTGTATGGTATAAACTCGAGTTTATACCATACAAATCTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012231.3-4657s21c1
Sequence:CCGGAGAGCTTTACACGACTATAAACTCGAGTTTATAGTCGTGTAAAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012231.3-1986s21c1
Sequence:GTACCGGGTCACATGCATATCCATATATCTCGAGATATATGGATATGCATGTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218523    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012231.3-7143s21c1
Sequence:GTACCGGTTCAAGAGTGAGCTATCAAACCTCGAGGTTTGATAGCTCACTCTTGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012231.3-5405s21c1
Sequence:CCGGACAGCGGATGCGGAGATTAAACTCGAGTTTAATCTCCGCATCCGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081355
VALIDATED
PRDM2 MISSION shRNA Bacterial Glycerol Stock
PR domain containing 2, with ZNF domain
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081355.2-3622s21c1
Sequence:CCGGTAAGGGTAAGACCGATCTATCCTCGAGGATAGATCGGTCTTACCCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081355.2-3658s21c1
Sequence:CCGGGCTTCATGGAGTCGGAAATATCTCGAGATATTTCCGACTCCATGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081355.2-3874s21c1
Sequence:CCGGTTCTAGAGAGGAGGAGTTAAACTCGAGTTTAACTCCTCCTCTCTAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239395    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081355.2-5797s21c1
Sequence:CCGGTCAATAGCAAATAGCATATAGCTCGAGCTATATGCTATTTGCTATTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081355.2-2302s21c1
Sequence:CCGGTGTGACTTCTAGTAGGTTTAACTCGAGTTAAACCTACTAGAAGTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081355
VALIDATED
PRDM2 MISSION shRNA shRNA Plasmid DNA
PR domain containing 2, with ZNF domain
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081355.2-3622s21c1
Sequence:CCGGTAAGGGTAAGACCGATCTATCCTCGAGGATAGATCGGTCTTACCCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081355.2-3658s21c1
Sequence:CCGGGCTTCATGGAGTCGGAAATATCTCGAGATATTTCCGACTCCATGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081355.2-3874s21c1
Sequence:CCGGTTCTAGAGAGGAGGAGTTAAACTCGAGTTTAACTCCTCCTCTCTAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239395    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081355.2-5797s21c1
Sequence:CCGGTCAATAGCAAATAGCATATAGCTCGAGCTATATGCTATTTGCTATTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081355.2-2302s21c1
Sequence:CCGGTGTGACTTCTAGTAGGTTTAACTCGAGTTAAACCTACTAGAAGTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081355
VALIDATED
PRDM2 MISSION shRNA Lentiviral Transduction Particles
PR domain containing 2, with ZNF domain
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081355.2-3622s21c1
Sequence:CCGGTAAGGGTAAGACCGATCTATCCTCGAGGATAGATCGGTCTTACCCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081355.2-3658s21c1
Sequence:CCGGGCTTCATGGAGTCGGAAATATCTCGAGATATTTCCGACTCCATGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081355.2-3874s21c1
Sequence:CCGGTTCTAGAGAGGAGGAGTTAAACTCGAGTTTAACTCCTCCTCTCTAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239395    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081355.2-5797s21c1
Sequence:CCGGTCAATAGCAAATAGCATATAGCTCGAGCTATATGCTATTTGCTATTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081355.2-2302s21c1
Sequence:CCGGTGTGACTTCTAGTAGGTTTAACTCGAGTTAAACCTACTAGAAGTCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)