EMAIL THIS PAGE TO A FRIEND

PRDM4

PR domain containing 4

87 Gene Product Result for
Synonyms: PFM1
UniProtKB ID: Q9UKN5, Q9UFA6
Gene ID:
Human(11108) Summary: The protein encoded by this gene is a transcription factor of the PR-domain protein family. It contains a PR-domain and multiple zinc finger motifs. Transcription factors of the PR-domain family are known to be involved in cell differentiation and tumorigenesis. An elevated expression level of this gene has been observed in PC12 cells treated with nerve growth factor, beta polypeptide (NGF). This gene is located in a chromosomal region that is thought to contain tumor suppressor genes. [provided by RefSeq, Jul 2008]
Mouse(72843) PR domain containing 4
Rat(170820) PR domain containing 4
Zebrafish(100000537) PR domain containing 4
chicken(418065) PR domain containing 4
Horse(100054098) PR domain containing 4
domestic cat(101089949) PR domain containing 4
dog(481291) PR domain containing 4
domestic guinea pig(100734481) PR domain containing 4
Domestic Rabbit(100328737) PR domain containing 4
naked mole-rat(101718300) PR domain containing 4
cow(540731) PR domain containing 4
sheep(101117746) PR domain containing 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012406 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012406 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012406 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181650 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181650 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181650 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012406 Rosetta Predictions human pricing
NM_133312 Rosetta Predictions rat pricing
NM_181650 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012406 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110839 predicted 2556
2 SASI_Hs02_00344248 predicted 1754
3 SASI_Hs02_00344249 predicted 2016
4 SASI_Hs02_00344250 predicted 1528
5 SASI_Hs01_00110842 predicted 1831
6 SASI_Hs01_00110844 predicted 1248
7 SASI_Hs02_00344251 predicted 2802
8 SASI_Hs01_00110845 predicted 2455
9 SASI_Hs01_00110846 predicted 850
10 SASI_Hs01_00110848 predicted 2531
11 SASI_Hs01_00110840 predicted 823
12 SASI_Hs01_00110841 predicted 1854
13 SASI_Hs01_00110843 predicted 833
14 SASI_Hs01_00110847 predicted 2262
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133312 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078130 predicted 708
2 SASI_Rn01_00078132 predicted 387
3 SASI_Rn01_00078133 predicted 269
4 SASI_Rn01_00078134 predicted 620
5 SASI_Rn02_00267617 predicted 887
6 SASI_Rn01_00078135 predicted 1345
7 SASI_Rn01_00078136 predicted 284
8 SASI_Rn01_00078137 predicted 1404
9 SASI_Rn01_00078138 predicted 1422
10 SASI_Rn01_00078139 predicted 899
11 SASI_Rn01_00078131 predicted 508
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181650 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163847 predicted 621
2 SASI_Mm01_00163849 predicted 609
3 SASI_Mm02_00349882 predicted 1673
4 SASI_Mm01_00163850 predicted 912
5 SASI_Mm02_00349883 predicted 2564
6 SASI_Mm01_00163852 predicted 2529
7 SASI_Mm01_00163853 predicted 963
8 SASI_Mm01_00163854 predicted 638
9 SASI_Mm01_00163855 predicted 2835
10 SASI_Mm01_00163856 predicted 2454
11 SASI_Mm01_00163848 predicted 737
12 SASI_Mm01_00163851 predicted 1717
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012406
VALIDATED
PRDM4 MISSION shRNA Bacterial Glycerol Stock
PR domain containing 4
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012406.3-3338s21c1
Sequence:GTACCGGACTTGGCAGCTAGTAAGTTTACTCGAGTAAACTTACTAGCTGCCAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012406.3-999s21c1
Sequence:CCGGTTGGACACAGCAATCACTATGCTCGAGCATAGTGATTGCTGTGTCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_012406.3-2025s21c1
Sequence:CCGGCGAGATTATGCTCAACAGATTCTCGAGAATCTGTTGAGCATAATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012406.3-2894s21c1
Sequence:CCGGCATAACCAGTTATCTACTATACTCGAGTATAGTAGATAACTGGTTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_012406.3-809s21c1
Sequence:CCGGCATCCACCCTAACTCTATAAACTCGAGTTTATAGAGTTAGGGTGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_012406.3-2583s21c1
Sequence:CCGGCACTTAAAGAAGCATCTCAATCTCGAGATTGAGATGCTTCTTTAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012406.3-3514s1c1
Sequence:CCGGGCCCAAGAAATTAGCTTTGATCTCGAGATCAAAGCTAATTTCTTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012406.3-882s1c1
Sequence:CCGGCCCTATCAGTCCAATGGAAATCTCGAGATTTCCATTGGACTGATAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012406.3-2583s1c1
Sequence:CCGGCACTTAAAGAAGCATCTCAATCTCGAGATTGAGATGCTTCTTTAAGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012406.3-1043s1c1
Sequence:CCGGCCCAATTTCGACAGATGGAATCTCGAGATTCCATCTGTCGAAATTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012406.3-2025s1c1
Sequence:CCGGCGAGATTATGCTCAACAGATTCTCGAGAATCTGTTGAGCATAATCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012406
VALIDATED
PRDM4 MISSION shRNA shRNA Plasmid DNA
PR domain containing 4
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012406.3-3338s21c1
Sequence:GTACCGGACTTGGCAGCTAGTAAGTTTACTCGAGTAAACTTACTAGCTGCCAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012406.3-999s21c1
Sequence:CCGGTTGGACACAGCAATCACTATGCTCGAGCATAGTGATTGCTGTGTCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_012406.3-2025s21c1
Sequence:CCGGCGAGATTATGCTCAACAGATTCTCGAGAATCTGTTGAGCATAATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012406.3-2894s21c1
Sequence:CCGGCATAACCAGTTATCTACTATACTCGAGTATAGTAGATAACTGGTTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_012406.3-809s21c1
Sequence:CCGGCATCCACCCTAACTCTATAAACTCGAGTTTATAGAGTTAGGGTGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_012406.3-2583s21c1
Sequence:CCGGCACTTAAAGAAGCATCTCAATCTCGAGATTGAGATGCTTCTTTAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012406.3-3514s1c1
Sequence:CCGGGCCCAAGAAATTAGCTTTGATCTCGAGATCAAAGCTAATTTCTTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012406.3-882s1c1
Sequence:CCGGCCCTATCAGTCCAATGGAAATCTCGAGATTTCCATTGGACTGATAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012406.3-2583s1c1
Sequence:CCGGCACTTAAAGAAGCATCTCAATCTCGAGATTGAGATGCTTCTTTAAGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012406.3-1043s1c1
Sequence:CCGGCCCAATTTCGACAGATGGAATCTCGAGATTCCATCTGTCGAAATTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012406.3-2025s1c1
Sequence:CCGGCGAGATTATGCTCAACAGATTCTCGAGAATCTGTTGAGCATAATCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012406
VALIDATED
PRDM4 MISSION shRNA Lentiviral Transduction Particles
PR domain containing 4
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012406.3-3338s21c1
Sequence:GTACCGGACTTGGCAGCTAGTAAGTTTACTCGAGTAAACTTACTAGCTGCCAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012406.3-999s21c1
Sequence:CCGGTTGGACACAGCAATCACTATGCTCGAGCATAGTGATTGCTGTGTCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_012406.3-2025s21c1
Sequence:CCGGCGAGATTATGCTCAACAGATTCTCGAGAATCTGTTGAGCATAATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012406.3-2894s21c1
Sequence:CCGGCATAACCAGTTATCTACTATACTCGAGTATAGTAGATAACTGGTTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_012406.3-809s21c1
Sequence:CCGGCATCCACCCTAACTCTATAAACTCGAGTTTATAGAGTTAGGGTGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_012406.3-2583s21c1
Sequence:CCGGCACTTAAAGAAGCATCTCAATCTCGAGATTGAGATGCTTCTTTAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012406.3-3514s1c1
Sequence:CCGGGCCCAAGAAATTAGCTTTGATCTCGAGATCAAAGCTAATTTCTTGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012406.3-882s1c1
Sequence:CCGGCCCTATCAGTCCAATGGAAATCTCGAGATTTCCATTGGACTGATAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012406.3-2583s1c1
Sequence:CCGGCACTTAAAGAAGCATCTCAATCTCGAGATTGAGATGCTTCTTTAAGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012406.3-1043s1c1
Sequence:CCGGCCCAATTTCGACAGATGGAATCTCGAGATTCCATCTGTCGAAATTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012406.3-2025s1c1
Sequence:CCGGCGAGATTATGCTCAACAGATTCTCGAGAATCTGTTGAGCATAATCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181650
VALIDATED
PRDM4 MISSION shRNA Bacterial Glycerol Stock
PR domain containing 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000314147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181650.2-1929s21c1
Sequence:CCGGTTTCTATTACAGCCGGAATTACTCGAGTAATTCCGGCTGTAATAGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181650.2-2566s21c1
Sequence:CCGGGCTTATCTAACCAAGTACCATCTCGAGATGGTACTTGGTTAGATAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181650.2-2010s21c1
Sequence:CCGGGTGCAGTTCCTATTCAGAGTTCTCGAGAACTCTGAATAGGAACTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181650.2-939s21c1
Sequence:CCGGCCCAATCTCCACAGATGGAATCTCGAGATTCCATCTGTGGAGATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350172    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181650.2-3134s21c1
Sequence:CCGGGTGTTAGGAGGCCTGTAATTACTCGAGTAATTACAGGCCTCCTAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098905    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181650.2-3311s1c1
Sequence:CCGGCGTGGTTATGTGTATGCACATCTCGAGATGTGCATACACATAACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_181650.2-2566s1c1
Sequence:CCGGGCTTATCTAACCAAGTACCATCTCGAGATGGTACTTGGTTAGATAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_181650.2-1790s1c1
Sequence:CCGGCCGATGAGAATGAGTGTAATTCTCGAGAATTACACTCATTCTCATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_181650.2-2010s1c1
Sequence:CCGGGTGCAGTTCCTATTCAGAGTTCTCGAGAACTCTGAATAGGAACTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_181650.2-939s1c1
Sequence:CCGGCCCAATCTCCACAGATGGAATCTCGAGATTCCATCTGTGGAGATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181650
VALIDATED
PRDM4 MISSION shRNA shRNA Plasmid DNA
PR domain containing 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000314147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181650.2-1929s21c1
Sequence:CCGGTTTCTATTACAGCCGGAATTACTCGAGTAATTCCGGCTGTAATAGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181650.2-2566s21c1
Sequence:CCGGGCTTATCTAACCAAGTACCATCTCGAGATGGTACTTGGTTAGATAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181650.2-2010s21c1
Sequence:CCGGGTGCAGTTCCTATTCAGAGTTCTCGAGAACTCTGAATAGGAACTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181650.2-939s21c1
Sequence:CCGGCCCAATCTCCACAGATGGAATCTCGAGATTCCATCTGTGGAGATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350172    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181650.2-3134s21c1
Sequence:CCGGGTGTTAGGAGGCCTGTAATTACTCGAGTAATTACAGGCCTCCTAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098905    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181650.2-3311s1c1
Sequence:CCGGCGTGGTTATGTGTATGCACATCTCGAGATGTGCATACACATAACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_181650.2-2566s1c1
Sequence:CCGGGCTTATCTAACCAAGTACCATCTCGAGATGGTACTTGGTTAGATAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_181650.2-1790s1c1
Sequence:CCGGCCGATGAGAATGAGTGTAATTCTCGAGAATTACACTCATTCTCATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_181650.2-2010s1c1
Sequence:CCGGGTGCAGTTCCTATTCAGAGTTCTCGAGAACTCTGAATAGGAACTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_181650.2-939s1c1
Sequence:CCGGCCCAATCTCCACAGATGGAATCTCGAGATTCCATCTGTGGAGATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181650
VALIDATED
PRDM4 MISSION shRNA Lentiviral Transduction Particles
PR domain containing 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000314147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181650.2-1929s21c1
Sequence:CCGGTTTCTATTACAGCCGGAATTACTCGAGTAATTCCGGCTGTAATAGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181650.2-2566s21c1
Sequence:CCGGGCTTATCTAACCAAGTACCATCTCGAGATGGTACTTGGTTAGATAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181650.2-2010s21c1
Sequence:CCGGGTGCAGTTCCTATTCAGAGTTCTCGAGAACTCTGAATAGGAACTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181650.2-939s21c1
Sequence:CCGGCCCAATCTCCACAGATGGAATCTCGAGATTCCATCTGTGGAGATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350172    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181650.2-3134s21c1
Sequence:CCGGGTGTTAGGAGGCCTGTAATTACTCGAGTAATTACAGGCCTCCTAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098905    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181650.2-3311s1c1
Sequence:CCGGCGTGGTTATGTGTATGCACATCTCGAGATGTGCATACACATAACCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_181650.2-2566s1c1
Sequence:CCGGGCTTATCTAACCAAGTACCATCTCGAGATGGTACTTGGTTAGATAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_181650.2-1790s1c1
Sequence:CCGGCCGATGAGAATGAGTGTAATTCTCGAGAATTACACTCATTCTCATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_181650.2-2010s1c1
Sequence:CCGGGTGCAGTTCCTATTCAGAGTTCTCGAGAACTCTGAATAGGAACTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_181650.2-939s1c1
Sequence:CCGGCCCAATCTCCACAGATGGAATCTCGAGATTCCATCTGTGGAGATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)