EMAIL THIS PAGE TO A FRIEND

PRDM5

PR domain containing 5

60 Gene Product Result for
Synonyms: BCS2 PFM2
UniProtKB ID: Q9NQX1, Q0VAJ0, Q6NXQ7
Gene ID:
Human(11107) Summary: The protein encoded by this gene is a transcription factor of the PR-domain protein family. It contains a PR-domain and multiple zinc finger motifs. Transcription factors of the PR-domain family are known to be involved in cell differentiation and tumorigenesis. [provided by RefSeq, Jul 2008]
Mouse(70779) PR domain containing 5
Rat(689788) PR domain containing 5
cow(537500) PR domain containing 5
sheep(101115210) PR domain containing 5
naked mole-rat(101714200) PR domain containing 5
Domestic Rabbit(100341114) PR domain containing 5
domestic guinea pig(100720910) PR domain containing 5
Zebrafish(432371) PR domain containing 5
Horse(100072313) PR domain containing 5
dog(483850) PR domain containing 5
chicken(422673) PR domain containing 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027547 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027547 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027547 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018699 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018699 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018699 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU004201 MISSION® esiRNA targeting mouse Prdm5 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018699 Rosetta Predictions human pricing
XM_001072014 Rosetta Predictions rat pricing
NM_027547 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018699 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153535 predicted 870
2 SASI_Hs02_00352228 predicted 1375
3 SASI_Hs01_00153536 predicted 1561
4 SASI_Hs01_00153537 predicted 1653
5 SASI_Hs01_00153538 predicted 1292
6 SASI_Hs01_00153539 predicted 857
7 SASI_Hs01_00153540 predicted 695
8 SASI_Hs01_00153541 predicted 1638
9 SASI_Hs01_00153543 predicted 1842
10 SASI_Hs01_00153544 predicted 1309
11 SASI_Hs01_00153542 predicted 1629
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072014 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00337384 predicted 1726
2 SASI_Rn02_00337385 predicted 1815
3 SASI_Rn02_00337386 predicted 1722
4 SASI_Rn02_00337387 predicted 1723
5 SASI_Rn02_00337388 predicted 1769
6 SASI_Rn02_00337389 predicted 1723
7 SASI_Rn02_00337390 predicted 1715
8 SASI_Rn02_00337391 predicted 1804
9 SASI_Rn02_00337392 predicted 1694
10 SASI_Rn02_00337393 predicted 1819
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027547 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157634 predicted 1037
2 SASI_Mm01_00157635 predicted 1464
3 SASI_Mm01_00157636 predicted 1310
4 SASI_Mm01_00157637 predicted 1593
5 SASI_Mm01_00157638 predicted 1515
6 SASI_Mm01_00157639 predicted 999
7 SASI_Mm01_00157640 predicted 1058
8 SASI_Mm01_00157641 predicted 1108
9 SASI_Mm01_00157642 predicted 981
10 SASI_Mm01_00157643 predicted 819
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027547
VALIDATED
PRDM5 MISSION shRNA Bacterial Glycerol Stock
PR domain containing 5
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000312863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027547.2-458s21c1
Sequence:CCGGTACTTGGCAGTTGATGATATACTCGAGTATATCATCAACTGCCAAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081588    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027547.1-1912s1c1
Sequence:CCGGCCCAGATTCTTCTCACCTGATCTCGAGATCAGGTGAGAAGAATCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027547.1-1779s1c1
Sequence:CCGGGTGCCATTTCTGCCATAAGAACTCGAGTTCTTATGGCAGAAATGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027547.1-251s1c1
Sequence:CCGGGCAAGGGAGAAGTTCTGTATACTCGAGTATACAGAACTTCTCCCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027547.1-526s1c1
Sequence:CCGGGCTGGAAGTAAAGGTCACCTTCTCGAGAAGGTGACCTTTACTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027547.1-1005s1c1
Sequence:CCGGGCGGCCTTATAACTGTGAGATCTCGAGATCTCACAGTTATAAGGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027547.2-1047s21c1
Sequence:CCGGAGCTGAAGCGTCACATGATTACTCGAGTAATCATGTGACGCTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312866    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027547.2-1964s21c1
Sequence:CCGGTGTGAAAGAGCTTCTACTATGCTCGAGCATAGTAGAAGCTCTTTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027547.2-1635s21c1
Sequence:CCGGACGGACTGAAGATGCACATTCCTCGAGGAATGTGCATCTTCAGTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027547.2-1198s21c1
Sequence:CCGGCTTTGCTCACAGAAACGTTTACTCGAGTAAACGTTTCTGTGAGCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027547.2-327s21c1
Sequence:CCGGGCAAGGGAGAAGTTCTGTATACTCGAGTATACAGAACTTCTCCCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027547
VALIDATED
PRDM5 MISSION shRNA shRNA Plasmid DNA
PR domain containing 5
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000312863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027547.2-458s21c1
Sequence:CCGGTACTTGGCAGTTGATGATATACTCGAGTATATCATCAACTGCCAAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081588    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027547.1-1912s1c1
Sequence:CCGGCCCAGATTCTTCTCACCTGATCTCGAGATCAGGTGAGAAGAATCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027547.1-1779s1c1
Sequence:CCGGGTGCCATTTCTGCCATAAGAACTCGAGTTCTTATGGCAGAAATGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027547.1-251s1c1
Sequence:CCGGGCAAGGGAGAAGTTCTGTATACTCGAGTATACAGAACTTCTCCCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027547.1-526s1c1
Sequence:CCGGGCTGGAAGTAAAGGTCACCTTCTCGAGAAGGTGACCTTTACTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027547.1-1005s1c1
Sequence:CCGGGCGGCCTTATAACTGTGAGATCTCGAGATCTCACAGTTATAAGGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027547.2-1047s21c1
Sequence:CCGGAGCTGAAGCGTCACATGATTACTCGAGTAATCATGTGACGCTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312866    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027547.2-1964s21c1
Sequence:CCGGTGTGAAAGAGCTTCTACTATGCTCGAGCATAGTAGAAGCTCTTTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027547.2-1635s21c1
Sequence:CCGGACGGACTGAAGATGCACATTCCTCGAGGAATGTGCATCTTCAGTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027547.2-1198s21c1
Sequence:CCGGCTTTGCTCACAGAAACGTTTACTCGAGTAAACGTTTCTGTGAGCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027547.2-327s21c1
Sequence:CCGGGCAAGGGAGAAGTTCTGTATACTCGAGTATACAGAACTTCTCCCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027547
VALIDATED
PRDM5 MISSION shRNA Lentiviral Transduction Particles
PR domain containing 5
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000312863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027547.2-458s21c1
Sequence:CCGGTACTTGGCAGTTGATGATATACTCGAGTATATCATCAACTGCCAAGTATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000081588    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027547.1-1912s1c1
Sequence:CCGGCCCAGATTCTTCTCACCTGATCTCGAGATCAGGTGAGAAGAATCTGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000081592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027547.1-1779s1c1
Sequence:CCGGGTGCCATTTCTGCCATAAGAACTCGAGTTCTTATGGCAGAAATGGCACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000081591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027547.1-251s1c1
Sequence:CCGGGCAAGGGAGAAGTTCTGTATACTCGAGTATACAGAACTTCTCCCTTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000081589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027547.1-526s1c1
Sequence:CCGGGCTGGAAGTAAAGGTCACCTTCTCGAGAAGGTGACCTTTACTTCCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000081590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027547.1-1005s1c1
Sequence:CCGGGCGGCCTTATAACTGTGAGATCTCGAGATCTCACAGTTATAAGGCCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000374261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027547.2-1047s21c1
Sequence:CCGGAGCTGAAGCGTCACATGATTACTCGAGTAATCATGTGACGCTTCAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000312866    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027547.2-1964s21c1
Sequence:CCGGTGTGAAAGAGCTTCTACTATGCTCGAGCATAGTAGAAGCTCTTTCACATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000374260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027547.2-1635s21c1
Sequence:CCGGACGGACTGAAGATGCACATTCCTCGAGGAATGTGCATCTTCAGTCCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000312864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027547.2-1198s21c1
Sequence:CCGGCTTTGCTCACAGAAACGTTTACTCGAGTAAACGTTTCTGTGAGCAAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000349354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027547.2-327s21c1
Sequence:CCGGGCAAGGGAGAAGTTCTGTATACTCGAGTATACAGAACTTCTCCCTTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018699
PRDM5 MISSION shRNA Bacterial Glycerol Stock
PR domain containing 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018699.2-1792s1c1
Sequence:CCGGGCGTCCCTATCAATGTCCTTACTCGAGTAAGGACATTGATAGGGACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018699.2-2126s21c1
Sequence:CCGGGGTGTAGCTGACAGCTAATAGCTCGAGCTATTAGCTGTCAGCTACACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018699.2-1287s21c1
Sequence:CCGGGACCCTATAATTGCGAGATTTCTCGAGAAATCTCGCAATTATAGGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018699.2-2181s1c1
Sequence:CCGGCCTAATATGAATCCCAGATTTCTCGAGAAATCTGGGATTCATATTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018699.2-1299s1c1
Sequence:CCGGGCGAGATTTGTAATAAGTCTTCTCGAGAAGACTTATTACAAATCTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018699.2-539s1c1
Sequence:CCGGGCTGCCATTCAAGAAGGAGAACTCGAGTTCTCCTTCTTGAATGGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018699.2-655s1c1
Sequence:CCGGGCAAATTATGACAGTCATCAACTCGAGTTGATGACTGTCATAATTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018699.2-1554s21c1
Sequence:CCGGATCACTGCGATGCTACCTTTACTCGAGTAAAGGTAGCATCGCAGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018699
PRDM5 MISSION shRNA shRNA Plasmid DNA
PR domain containing 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018699.2-1792s1c1
Sequence:CCGGGCGTCCCTATCAATGTCCTTACTCGAGTAAGGACATTGATAGGGACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018699.2-2126s21c1
Sequence:CCGGGGTGTAGCTGACAGCTAATAGCTCGAGCTATTAGCTGTCAGCTACACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018699.2-1287s21c1
Sequence:CCGGGACCCTATAATTGCGAGATTTCTCGAGAAATCTCGCAATTATAGGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018699.2-2181s1c1
Sequence:CCGGCCTAATATGAATCCCAGATTTCTCGAGAAATCTGGGATTCATATTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018699.2-1299s1c1
Sequence:CCGGGCGAGATTTGTAATAAGTCTTCTCGAGAAGACTTATTACAAATCTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018699.2-539s1c1
Sequence:CCGGGCTGCCATTCAAGAAGGAGAACTCGAGTTCTCCTTCTTGAATGGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018699.2-655s1c1
Sequence:CCGGGCAAATTATGACAGTCATCAACTCGAGTTGATGACTGTCATAATTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018699.2-1554s21c1
Sequence:CCGGATCACTGCGATGCTACCTTTACTCGAGTAAAGGTAGCATCGCAGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018699
PRDM5 MISSION shRNA Lentiviral Transduction Particles
PR domain containing 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018699.2-1792s1c1
Sequence:CCGGGCGTCCCTATCAATGTCCTTACTCGAGTAAGGACATTGATAGGGACGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000378303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018699.2-2126s21c1
Sequence:CCGGGGTGTAGCTGACAGCTAATAGCTCGAGCTATTAGCTGTCAGCTACACCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000358512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018699.2-1287s21c1
Sequence:CCGGGACCCTATAATTGCGAGATTTCTCGAGAAATCTCGCAATTATAGGGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000015258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018699.2-2181s1c1
Sequence:CCGGCCTAATATGAATCCCAGATTTCTCGAGAAATCTGGGATTCATATTAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000015259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018699.2-1299s1c1
Sequence:CCGGGCGAGATTTGTAATAAGTCTTCTCGAGAAGACTTATTACAAATCTCGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000015260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018699.2-539s1c1
Sequence:CCGGGCTGCCATTCAAGAAGGAGAACTCGAGTTCTCCTTCTTGAATGGCAGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000015262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018699.2-655s1c1
Sequence:CCGGGCAAATTATGACAGTCATCAACTCGAGTTGATGACTGTCATAATTTGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000358511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018699.2-1554s21c1
Sequence:CCGGATCACTGCGATGCTACCTTTACTCGAGTAAAGGTAGCATCGCAGTGATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???