EMAIL THIS PAGE TO A FRIEND

PRDM6

PR domain containing 6

142 Gene Product Result for
UniProtKB ID: Q9NQX0, B5MCJ4, Q9NQW9
Gene ID:
Mouse(225518) PR domain containing 6
Rat(307305) PR domain containing 6
Zebrafish(100169948) PR domain containing 6
domestic cat(101084511) PR domain containing 6
Horse(100073092) PR domain containing 6
dog(100687856) PR domain containing 6
chicken(426800) PR domain containing 6
domestic guinea pig(100734472) PR domain containing 6
Domestic Rabbit(100354345) PR domain containing 6
naked mole-rat(101720211) PR domain containing 6
cow(519857) PR domain containing 6
sheep(101103235) PR domain containing 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001136239 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001136239 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001136239 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033281 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033281 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033281 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001723255 Rosetta Predictions human pricing
XM_927647 Rosetta Predictions human pricing
XM_937753 Rosetta Predictions human pricing
XM_001058066 Rosetta Predictions rat pricing
XM_225764 Rosetta Predictions rat pricing
NM_001033281 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001723255 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00454259 predicted 1748
2 SASI_Hs02_00454260 predicted 926
3 SASI_Hs02_00454261 predicted 1758
4 SASI_Hs02_00454262 predicted 1312
5 SASI_Hs02_00454263 predicted 1870
6 SASI_Hs02_00454264 predicted 1322
7 SASI_Hs02_00454265 predicted 1611
8 SASI_Hs02_00454266 predicted 1683
9 SASI_Hs02_00454267 predicted 1024
10 SASI_Hs02_00454268 predicted 1814
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927647 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00480630 predicted 1762
2 SASI_Hs02_00480631 predicted 945
3 SASI_Hs02_00480632 predicted 1777
4 SASI_Hs02_00480633 predicted 1328
5 SASI_Hs02_00480634 predicted 1885
6 SASI_Hs02_00480635 predicted 1346
7 SASI_Hs02_00480636 predicted 1619
8 SASI_Hs02_00480637 predicted 1700
9 SASI_Hs02_00480638 predicted 1047
10 SASI_Hs02_00480639 predicted 1832
11 SASI_Hs01_00279218 predicted 383
12 SASI_Hs01_00279219 predicted 220
13 SASI_Hs01_00279220 predicted 383
14 SASI_Hs01_00279221 predicted 204
15 SASI_Hs01_00279222 predicted 252
16 SASI_Hs01_00279223 predicted 257
17 SASI_Hs01_00279224 predicted 380
18 SASI_Hs01_00279225 predicted 270
19 SASI_Hs01_00279226 predicted 221
20 SASI_Hs01_00279227 predicted 257
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_937753 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00482719 predicted 1763
2 SASI_Hs02_00482720 predicted 936
3 SASI_Hs02_00482721 predicted 1770
4 SASI_Hs02_00482722 predicted 1319
5 SASI_Hs02_00482723 predicted 1877
6 SASI_Hs02_00482724 predicted 1332
7 SASI_Hs02_00482725 predicted 1617
8 SASI_Hs02_00482726 predicted 1692
9 SASI_Hs02_00482727 predicted 1034
10 SASI_Hs02_00482728 predicted 1821
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058066 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00288445 predicted 1684
2 SASI_Rn02_00288446 predicted 2619
3 SASI_Rn02_00288447 predicted 2566
4 SASI_Rn02_00288448 predicted 2343
5 SASI_Rn02_00288449 predicted 2204
6 SASI_Rn02_00288450 predicted 1969
7 SASI_Rn02_00288451 predicted 2503
8 SASI_Rn02_00288452 predicted 2541
9 SASI_Rn02_00288453 predicted 1919
10 SASI_Rn02_00288454 predicted 1782
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225764 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383134 predicted 1826
2 SASI_Rn02_00383135 predicted 1953
3 SASI_Rn02_00383136 predicted 282
4 SASI_Rn02_00383137 predicted 1998
5 SASI_Rn02_00383138 predicted 1461
6 SASI_Rn02_00383139 predicted 256
7 SASI_Rn02_00383140 predicted 283
8 SASI_Rn02_00383141 predicted 2031
9 SASI_Rn02_00383142 predicted 2063
10 SASI_Rn02_00383143 predicted 2232
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033281 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169088 predicted 1789
2 SASI_Mm01_00169089 predicted 1874
3 SASI_Mm02_00288484 predicted 933
4 SASI_Mm01_00169090 predicted 1788
5 SASI_Mm01_00169091 predicted 1811
6 SASI_Mm01_00169092 predicted 1760
7 SASI_Mm01_00169094 predicted 1840
8 SASI_Mm01_00169095 predicted 1760
9 SASI_Mm01_00169096 predicted 1464
10 SASI_Mm01_00169097 predicted 1597
11 SASI_Mm01_00169093 predicted 972
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001136239
VALIDATED
PRDM6 MISSION shRNA Bacterial Glycerol Stock
PR domain containing 6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001136239.1-1407s21c1
Sequence:CCGGGTTCAGTACAGGTCGAATATACTCGAGTATATTCGACCTGTACTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001136239.1-1700s21c1
Sequence:CCGGGCCCATTGAATCAGGATTTAACTCGAGTTAAATCCTGATTCAATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001136239.1-1275s21c1
Sequence:CCGGCAGCATCTCTGGGAGATATATCTCGAGATATATCTCCCAGAGATGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136239.1-2201s21c1
Sequence:CCGGCTGCAAGGAAAGTCATGATTACTCGAGTAATCATGACTTTCCTTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136239.1-1430s21c1
Sequence:CCGGCTACCGAGCCTGTATAGATATCTCGAGATATCTATACAGGCTCGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001136239
VALIDATED
PRDM6 MISSION shRNA shRNA Plasmid DNA
PR domain containing 6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001136239.1-1407s21c1
Sequence:CCGGGTTCAGTACAGGTCGAATATACTCGAGTATATTCGACCTGTACTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001136239.1-1700s21c1
Sequence:CCGGGCCCATTGAATCAGGATTTAACTCGAGTTAAATCCTGATTCAATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001136239.1-1275s21c1
Sequence:CCGGCAGCATCTCTGGGAGATATATCTCGAGATATATCTCCCAGAGATGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136239.1-2201s21c1
Sequence:CCGGCTGCAAGGAAAGTCATGATTACTCGAGTAATCATGACTTTCCTTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136239.1-1430s21c1
Sequence:CCGGCTACCGAGCCTGTATAGATATCTCGAGATATCTATACAGGCTCGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001136239
VALIDATED
PRDM6 MISSION shRNA Lentiviral Transduction Particles
PR domain containing 6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001136239.1-1407s21c1
Sequence:CCGGGTTCAGTACAGGTCGAATATACTCGAGTATATTCGACCTGTACTGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001136239.1-1700s21c1
Sequence:CCGGGCCCATTGAATCAGGATTTAACTCGAGTTAAATCCTGATTCAATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001136239.1-1275s21c1
Sequence:CCGGCAGCATCTCTGGGAGATATATCTCGAGATATATCTCCCAGAGATGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136239.1-2201s21c1
Sequence:CCGGCTGCAAGGAAAGTCATGATTACTCGAGTAATCATGACTTTCCTTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136239.1-1430s21c1
Sequence:CCGGCTACCGAGCCTGTATAGATATCTCGAGATATCTATACAGGCTCGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033281
PRDM6 MISSION shRNA Bacterial Glycerol Stock
PR domain containing 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033281.3-1814s21c1
Sequence:CCGGCTGATTGACTGGCCGGAATTACTCGAGTAATTCCGGCCAGTCAATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033281.3-1066s21c1
Sequence:CCGGCTACCGAGCCTGTATAGATATCTCGAGATATCTATACAGGCTCGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033281.3-608s21c1
Sequence:CCGGCCCAACAACCGTTGCGATATGCTCGAGCATATCGCAACGGTTGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033281.3-1180s21c1
Sequence:CCGGGAACGTCCCTTCCACCGTAATCTCGAGATTACGGTGGAAGGGACGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033281.3-1043s21c1
Sequence:CCGGGTTCAGTACAGGTCGAATATACTCGAGTATATTCGACCTGTACTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033281
PRDM6 MISSION shRNA shRNA Plasmid DNA
PR domain containing 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033281.3-1814s21c1
Sequence:CCGGCTGATTGACTGGCCGGAATTACTCGAGTAATTCCGGCCAGTCAATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033281.3-1066s21c1
Sequence:CCGGCTACCGAGCCTGTATAGATATCTCGAGATATCTATACAGGCTCGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033281.3-608s21c1
Sequence:CCGGCCCAACAACCGTTGCGATATGCTCGAGCATATCGCAACGGTTGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033281.3-1180s21c1
Sequence:CCGGGAACGTCCCTTCCACCGTAATCTCGAGATTACGGTGGAAGGGACGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033281.3-1043s21c1
Sequence:CCGGGTTCAGTACAGGTCGAATATACTCGAGTATATTCGACCTGTACTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033281
PRDM6 MISSION shRNA Lentiviral Transduction Particles
PR domain containing 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033281.3-1814s21c1
Sequence:CCGGCTGATTGACTGGCCGGAATTACTCGAGTAATTCCGGCCAGTCAATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033281.3-1066s21c1
Sequence:CCGGCTACCGAGCCTGTATAGATATCTCGAGATATCTATACAGGCTCGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033281.3-608s21c1
Sequence:CCGGCCCAACAACCGTTGCGATATGCTCGAGCATATCGCAACGGTTGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033281.3-1180s21c1
Sequence:CCGGGAACGTCCCTTCCACCGTAATCTCGAGATTACGGTGGAAGGGACGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033281.3-1043s21c1
Sequence:CCGGGTTCAGTACAGGTCGAATATACTCGAGTATATTCGACCTGTACTGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)