EMAIL THIS PAGE TO A FRIEND

PRDM7

PR domain containing 7

72 Gene Product Result for
Synonyms: PFM4 ZNF910
UniProtKB ID: Q9NQW5, A4Q9G8, Q08EM4, Q9NQW4
Gene ID:
Human(11105) Summary: The protein encoded by this gene is a transcription factor of the PR-domain protein family. It contains a PR-domain and multiple zinc finger motifs. Transcription factors of the PR-domain family are known to be involved in cell differentiation and tumorigenesis. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
cow(516002) PR domain containing 7
Domestic Rabbit(100358830) PR domain containing 7
domestic cat(101085009) PR domain containing 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052996 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052996 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052996 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU104171 MISSION® esiRNA targeting human LINC01602 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098173 Rosetta Predictions human pricing
NM_052996 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098173 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318588 predicted 1874
2 SASI_Hs02_00318589 predicted 1701
3 SASI_Hs02_00318590 predicted 1986
4 SASI_Hs02_00318591 predicted 1563
5 SASI_Hs02_00318592 predicted 1767
6 SASI_Hs02_00318593 predicted 1695
7 SASI_Hs02_00318594 predicted 884
8 SASI_Hs02_00318595 predicted 424
9 SASI_Hs02_00318596 predicted 420
10 SASI_Hs02_00318597 predicted 404
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052996 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361811 predicted 1097
2 SASI_Hs01_00149289 predicted 922
3 SASI_Hs02_00361812 predicted 775
4 SASI_Hs02_00361813 predicted 983
5 SASI_Hs01_00149291 predicted 912
6 SASI_Hs01_00149287 predicted 379
7 SASI_Hs01_00149293 predicted 383
8 SASI_Hs01_00149292 predicted 916
9 SASI_Hs01_00149288 predicted 801
10 SASI_Hs01_00149290 predicted 893
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052996
PRDM7 MISSION shRNA Bacterial Glycerol Stock
PR domain containing 7
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052996.2-1783s1c1
Sequence:CCGGCCTCTCCTGATTTCCTCCAATCTCGAGATTGGAGGAAATCAGGAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052996.2-460s1c1
Sequence:CCGGGCCAACTGGATGAGAACCAAACTCGAGTTTGGTTCTCATCCAGTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052996.2-387s1c1
Sequence:CCGGCAGTGGATATTCCTGGCTAATCTCGAGATTAGCCAGGAATATCCACTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052996.2-469s1c1
Sequence:CCGGATGAGAACCAAAGCCAGAGATCTCGAGATCTCTGGCTTTGGTTCTCATTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052996.2-388s21c1
Sequence:CCGGAGTGGATATTCCTGGCTAATCCTCGAGGATTAGCCAGGAATATCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052996.2-425s1c1
Sequence:CCGGGCTATGAGTATGTGGATGGAACTCGAGTTCCATCCACATACTCATAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052996.2-885s21c1
Sequence:CCGGCAAGAATTGCGAAAGTCAAATCTCGAGATTTGACTTTCGCAATTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052996.2-634s21c1
Sequence:CCGGGAATCAGGAGCGGCAATATTCCTCGAGGAATATTGCCGCTCCTGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052996
PRDM7 MISSION shRNA shRNA Plasmid DNA
PR domain containing 7
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052996.2-1783s1c1
Sequence:CCGGCCTCTCCTGATTTCCTCCAATCTCGAGATTGGAGGAAATCAGGAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052996.2-460s1c1
Sequence:CCGGGCCAACTGGATGAGAACCAAACTCGAGTTTGGTTCTCATCCAGTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052996.2-387s1c1
Sequence:CCGGCAGTGGATATTCCTGGCTAATCTCGAGATTAGCCAGGAATATCCACTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052996.2-469s1c1
Sequence:CCGGATGAGAACCAAAGCCAGAGATCTCGAGATCTCTGGCTTTGGTTCTCATTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052996.2-388s21c1
Sequence:CCGGAGTGGATATTCCTGGCTAATCCTCGAGGATTAGCCAGGAATATCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052996.2-425s1c1
Sequence:CCGGGCTATGAGTATGTGGATGGAACTCGAGTTCCATCCACATACTCATAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052996.2-885s21c1
Sequence:CCGGCAAGAATTGCGAAAGTCAAATCTCGAGATTTGACTTTCGCAATTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052996.2-634s21c1
Sequence:CCGGGAATCAGGAGCGGCAATATTCCTCGAGGAATATTGCCGCTCCTGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052996
PRDM7 MISSION shRNA Lentiviral Transduction Particles
PR domain containing 7
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052996.2-1783s1c1
Sequence:CCGGCCTCTCCTGATTTCCTCCAATCTCGAGATTGGAGGAAATCAGGAGAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000015175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052996.2-460s1c1
Sequence:CCGGGCCAACTGGATGAGAACCAAACTCGAGTTTGGTTCTCATCCAGTTGGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000015174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052996.2-387s1c1
Sequence:CCGGCAGTGGATATTCCTGGCTAATCTCGAGATTAGCCAGGAATATCCACTGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000015177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052996.2-469s1c1
Sequence:CCGGATGAGAACCAAAGCCAGAGATCTCGAGATCTCTGGCTTTGGTTCTCATTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000358508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052996.2-388s21c1
Sequence:CCGGAGTGGATATTCCTGGCTAATCCTCGAGGATTAGCCAGGAATATCCACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000015176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052996.2-425s1c1
Sequence:CCGGGCTATGAGTATGTGGATGGAACTCGAGTTCCATCCACATACTCATAGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000358509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052996.2-885s21c1
Sequence:CCGGCAAGAATTGCGAAAGTCAAATCTCGAGATTTGACTTTCGCAATTCTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000358480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052996.2-634s21c1
Sequence:CCGGGAATCAGGAGCGGCAATATTCCTCGAGGAATATTGCCGCTCCTGATTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???