EMAIL THIS PAGE TO A FRIEND

PRDM8

PR domain containing 8

117 Gene Product Result for
Synonyms: PFM5
UniProtKB ID: Q9NQV8, A8K7X2, Q6IQ36
Gene ID:
Mouse(77630) PR domain containing 8
Rat(305198) PR domain containing 8
Zebrafish(406719) PR domain containing 8
domestic cat(101093433) PR domain containing 8
dog(487823) PR domain containing 8
naked mole-rat(101701253) PR domain containing 8
domestic guinea pig(100722667) PR domain containing 8
cow(507890) PR domain containing 8
sheep(101107789) PR domain containing 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029947 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029947 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029947 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020226 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020226 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020226 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099403 Rosetta Predictions human pricing
NM_020226 Rosetta Predictions human pricing
NM_001107207 Rosetta Predictions rat pricing
NM_029947 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099403 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320559 predicted 357
2 SASI_Hs02_00320560 predicted 462
3 SASI_Hs02_00320561 predicted 359
4 SASI_Hs02_00320562 predicted 360
5 SASI_Hs02_00320563 predicted 563
6 SASI_Hs02_00320564 predicted 513
7 SASI_Hs02_00320565 predicted 413
8 SASI_Hs02_00320566 predicted 414
9 SASI_Hs02_00320567 predicted 402
10 SASI_Hs02_00320568 predicted 450
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020226 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240507 predicted 1325
2 SASI_Hs01_00240508 predicted 1427
3 SASI_Hs01_00240510 predicted 1326
4 SASI_Hs02_00353168 predicted 1326
5 SASI_Hs02_00353169 predicted 1531
6 SASI_Hs01_00240513 predicted 1478
7 SASI_Hs01_00240514 predicted 1375
8 SASI_Hs01_00240515 predicted 1386
9 SASI_Hs02_00353170 predicted 1363
10 SASI_Hs02_00353171 predicted 1418
11 SASI_Hs01_00240506 predicted 1016
12 SASI_Hs01_00240509 predicted 1056
13 SASI_Hs01_00240511 predicted 899
14 SASI_Hs01_00240512 predicted 1142
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107207 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226565 predicted 425
2 SASI_Rn02_00226566 predicted 410
3 SASI_Rn02_00226567 predicted 1209
4 SASI_Rn02_00226568 predicted 632
5 SASI_Rn02_00226569 predicted 905
6 SASI_Rn02_00226570 predicted 1343
7 SASI_Rn02_00226571 predicted 1148
8 SASI_Rn02_00226572 predicted 1319
9 SASI_Rn02_00226573 predicted 1142
10 SASI_Rn02_00226574 predicted 523
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029947 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142267 predicted 471
2 SASI_Mm01_00142269 predicted 451
3 SASI_Mm01_00142270 predicted 342
4 SASI_Mm01_00142271 predicted 547
5 SASI_Mm01_00142272 predicted 540
6 SASI_Mm02_00336247 predicted 2806
7 SASI_Mm01_00142273 predicted 593
8 SASI_Mm02_00336248 predicted 2799
9 SASI_Mm01_00142274 predicted 469
10 SASI_Mm01_00142275 predicted 538
11 SASI_Mm01_00142268 predicted 426
12 SASI_Mm01_00142276 predicted 407
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029947
PRDM8 MISSION shRNA Bacterial Glycerol Stock
PR domain containing 8
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029947.2-2687s21c1
Sequence:CCGGTTGCAACATATTGATGCATTTCTCGAGAAATGCATCAATATGTTGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029947.2-2154s21c1
Sequence:CCGGCTCCGACCTGGTGTACCATATCTCGAGATATGGTACACCAGGTCGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086008    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029947.1-2628s1c1
Sequence:CCGGGCACTTATGGTTTAGATGTAACTCGAGTTACATCTAAACCATAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029947.1-2016s1c1
Sequence:CCGGCGCCAAATGCAACGCCTCCTTCTCGAGAAGGAGGCGTTGCATTTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029947.2-520s21c1
Sequence:CCGGGTCCAATCAGCCCGAGATAAGCTCGAGCTTATCTCGGGCTGATTGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029947.1-499s1c1
Sequence:CCGGGCCAAAGATGAAGAGTTACTACTCGAGTAGTAACTCTTCATCTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029947.1-266s1c1
Sequence:CCGGCCTGTGTACTGAGCCATACTTCTCGAGAAGTATGGCTCAGTACACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029947.1-340s1c1
Sequence:CCGGGTACCTTACATCTTCCGGGTACTCGAGTACCCGGAAGATGTAAGGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029947
PRDM8 MISSION shRNA shRNA Plasmid DNA
PR domain containing 8
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029947.2-2687s21c1
Sequence:CCGGTTGCAACATATTGATGCATTTCTCGAGAAATGCATCAATATGTTGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029947.2-2154s21c1
Sequence:CCGGCTCCGACCTGGTGTACCATATCTCGAGATATGGTACACCAGGTCGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086008    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029947.1-2628s1c1
Sequence:CCGGGCACTTATGGTTTAGATGTAACTCGAGTTACATCTAAACCATAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029947.1-2016s1c1
Sequence:CCGGCGCCAAATGCAACGCCTCCTTCTCGAGAAGGAGGCGTTGCATTTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029947.2-520s21c1
Sequence:CCGGGTCCAATCAGCCCGAGATAAGCTCGAGCTTATCTCGGGCTGATTGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029947.1-499s1c1
Sequence:CCGGGCCAAAGATGAAGAGTTACTACTCGAGTAGTAACTCTTCATCTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029947.1-266s1c1
Sequence:CCGGCCTGTGTACTGAGCCATACTTCTCGAGAAGTATGGCTCAGTACACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029947.1-340s1c1
Sequence:CCGGGTACCTTACATCTTCCGGGTACTCGAGTACCCGGAAGATGTAAGGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029947
PRDM8 MISSION shRNA Lentiviral Transduction Particles
PR domain containing 8
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029947.2-2687s21c1
Sequence:CCGGTTGCAACATATTGATGCATTTCTCGAGAAATGCATCAATATGTTGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029947.2-2154s21c1
Sequence:CCGGCTCCGACCTGGTGTACCATATCTCGAGATATGGTACACCAGGTCGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086008    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029947.1-2628s1c1
Sequence:CCGGGCACTTATGGTTTAGATGTAACTCGAGTTACATCTAAACCATAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029947.1-2016s1c1
Sequence:CCGGCGCCAAATGCAACGCCTCCTTCTCGAGAAGGAGGCGTTGCATTTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029947.2-520s21c1
Sequence:CCGGGTCCAATCAGCCCGAGATAAGCTCGAGCTTATCTCGGGCTGATTGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029947.1-499s1c1
Sequence:CCGGGCCAAAGATGAAGAGTTACTACTCGAGTAGTAACTCTTCATCTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029947.1-266s1c1
Sequence:CCGGCCTGTGTACTGAGCCATACTTCTCGAGAAGTATGGCTCAGTACACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029947.1-340s1c1
Sequence:CCGGGTACCTTACATCTTCCGGGTACTCGAGTACCCGGAAGATGTAAGGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020226
PRDM8 MISSION shRNA Bacterial Glycerol Stock
PR domain containing 8
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000358531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020226.3-3279s21c1
Sequence:CCGGGGCACATGACCTCGCATAATTCTCGAGAATTATGCGAGGTCATGTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020226.3-1773s21c1
Sequence:CCGGGACTTCACAGCGCTGATATAACTCGAGTTATATCAGCGCTGTGAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020226.3-1533s21c1
Sequence:CCGGAGAACCTTGAAGCCTACATAACTCGAGTTATGTAGGCTTCAAGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020226.2-1140s1c1
Sequence:CCGGCAGAACCTTGAAGCCTACATACTCGAGTATGTAGGCTTCAAGGTTCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020226
PRDM8 MISSION shRNA shRNA Plasmid DNA
PR domain containing 8
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000358531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020226.3-3279s21c1
Sequence:CCGGGGCACATGACCTCGCATAATTCTCGAGAATTATGCGAGGTCATGTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020226.3-1773s21c1
Sequence:CCGGGACTTCACAGCGCTGATATAACTCGAGTTATATCAGCGCTGTGAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020226.3-1533s21c1
Sequence:CCGGAGAACCTTGAAGCCTACATAACTCGAGTTATGTAGGCTTCAAGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020226.2-1140s1c1
Sequence:CCGGCAGAACCTTGAAGCCTACATACTCGAGTATGTAGGCTTCAAGGTTCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020226
PRDM8 MISSION shRNA Lentiviral Transduction Particles
PR domain containing 8
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000358531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020226.3-3279s21c1
Sequence:CCGGGGCACATGACCTCGCATAATTCTCGAGAATTATGCGAGGTCATGTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020226.3-1773s21c1
Sequence:CCGGGACTTCACAGCGCTGATATAACTCGAGTTATATCAGCGCTGTGAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020226.3-1533s21c1
Sequence:CCGGAGAACCTTGAAGCCTACATAACTCGAGTTATGTAGGCTTCAAGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020226.2-1140s1c1
Sequence:CCGGCAGAACCTTGAAGCCTACATACTCGAGTATGTAGGCTTCAAGGTTCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)